Query (optional)   in Class  

GrainGenes Sequence Report: ABC176-5

[ Submit comment/correction ]

Sequence
ABC176-5
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data Source
Kuenzel, Gottfried98.05.05
Probe
ABC176
DNA Homology
AA660726602noncereal_EST
[ Show all 23 ]
DNA
cacgacagtgaagagaagaaacataaaggaactgaaggtgttattcaaat
cgaaaatccaaacctgtgaaagcaaagaatataaaagccaaggaagctga
tcttggaaagacaactgaactctcgaggcgtgagagggaggagatcgaga
agcaaaaatctcatgagcgttatatgaagcttcaggagcaaggcaaaaca
gaacaggcgaagaaagattttgaacgtcttgctttaataaggcagcaaag
ggcagatgctgcaaagaaacgtgaagaggagaagctgctaaagaacagag
gaagaccgaagcacgcaaataactgtgaaggttgtggaggcatgagctga
gctgagctttgtttggctggatatttatttctatgcatcttagtatattt
aaaccagggtctctattccattatctacatttccataaaaatcgtgcatt
tacctagtgtaaagtagtcctgtcggccgtgt
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.