Query (optional)   in Class  

GrainGenes Sequence Report: ABG460-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
ABG460-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
ABG460
DNA Homology
HUM402C04B146noncereal_EST
[ Show all 17 ]
DNA
aggtggcttaactgattctatggggagccaacacccaggtatagggtgta
ataaaaaaatatgaagaaactgacctcacatccaaggagccatcttgaat
ctttttgagaagtccagaaggaattgatccattcagcttgttgtttgaga
gatctctacataaagtaacatactgacacatgagtcaaagagaacacaag
ggacgttcaaattaacttgatcacagtagtagcaaaacttacaaaagtac
taatgattgtaatcgtgaaagggcatctggaattgatcctgtcaagttgt
tgtttgaaagatcccttcaaaacattgaccgatattttctttcaacactt
tttttcgaaaataaaagaatgcatactacaaggaatggtaaaaatggtag
atccacacgacagaacgtacatgtattggacgtccttgagatttacgaaa
tttggcgatatagcaccatgcagaccattgaaagacatgtttctacaagg
gtgaaagtggctcaattttacttttaccacacaacataagcggtatagat
ataaataacttacacgcttgtaatcgctggaggtttggaaacatcataa
BLAST
BLAST Search