Query (optional)   in Class  

GrainGenes Sequence Report: ABG460-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
ABG460-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
ABG460
DNA Homology
AA556197202noncereal_EST
[ Show all 89 ]
DNA
acatgtaggtttactgagaaacattatatactagagtattcttggaggag
agcggaagagatcaccgtactctggatctacatatcctggtgtgccggca
caggtgttggtggatatatgggtgccatcgtcccagttgaaagccttgga
caagccaaaatcggcaatcttggcctcaagccttgcatttagcaagatgt
tggcagttttaacatccatgtgcattataggtgggttacacgccttatgt
aggtactccagccctgctcattaccagtccagccaatggtcaagattctt
ga
BLAST
BLAST Search