Query (optional)   in Class  

GrainGenes Sequence Report: ABG474-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
ABG474-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
ABG474
DNA Homology
AA210073136noncereal_EST
[ Show all 19 ]
DNA
ttattagtccaaaccacaaccattttccagatttccacacagaaaggaca
aagcaggatgcaacaaatgaaaatgggtcgacaacccactgaacccaccc
acttaactgttgttcacttctctaacaagtggcttaagttggtgcacata
tctctttgacagaactaagatggatccgtgtgggtcgcccaacatggccc
acttgcattatattgttgccttttaagaacatgtcattctagtggagcca
aaaataataacatgttaaggcttcttttaagcttgatttaatttcaaatt
cgaggtgccagcatactcatttgcatataagctctccaagcgaagagcca
gctgacccggtaagatggttgatagtaacaaggccatagaaaatcataag
ccaagcctgggacaagcattcattgctataaaaaaccactttcaaccgta
acactaaaactactgttaaaaaagttgagcattctcagattttcgtccag
gcatattcacatgccaacacgacaaaaataatgcaatatcaacctaaagt
gttaacag
BLAST
BLAST Search