Query (optional)   in Class  

GrainGenes Sequence Report: ABG8-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
ABG8-5
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data Source
Kuenzel, Gottfried98.05.05
Probe
ABG8
DNA Homology
H43374140noncereal_EST
[ Show all 40 ]
DNA
cttgttctagtactatgtttatgttttccaattcatcccaatcctacaac
cactaccatgtagtgcgtgcagatttctcttccataacaaaatagactac
ttaagttctcccatccaatttgtttctatctagagtctatgcatattata
ctgaatatatagatctcagaaaatatgtgatattgtgaagcattactctg
ccaaacttctcaagacagtaatataacctgcacaggcgtgtacccgtgtt
ctcctaccaactgtacccaagtaccctatcgttactgtagatcattaata
aggacatgtaatactcacatgcttacacagtcattgtctattagtattac
gttccgtacatgctaaaattaacagatcttatttataaa
BLAST
BLAST Search