Query (optional)   in Class  

GrainGenes Sequence Report: AF155932

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AF155932
Subsequence
AF155932_1.cds1918
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q9LLS8
DB Remark
Locus Source: Avena sativa (oat)
Species
Avena sativa
Cultivar
Ogle
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
Avena sativa 1,3-beta glucanase (Oglc13) mRNA, partial cds.
Gene
Oglc13
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Gene: Oglc13
EMBL Feature
feature_gene11045Location: <1..1045
DNA
atcggtgtttgctacggcgtgactggcaacaacctcccgtcccgtagcga
cgtggttcagctgtaccgctccaagggcatcaccgacatgcgcatctact
tcgccgacgggcaggcgctgtccgcgctgcgcaactcaggcatcggcctc
gtcatggacatcggcaacgaccagctcggcaagatcgccggcagcgcctc
caacgcggccgcctgggtccgggacaacgtgcagcgttaccagggcctga
agatcaagtacatcgtggcgggcaacgagatccagggcggggacacgggg
cgcatcgtcccggccatccggaacctgaacgcggcgctgtccgcggcggg
cctcgggggcatcaaggtgtcgacggcgatccggttcgacgcggtggcga
actccttcccgccctcggccggcgtgttcgcgcagtcctacatgacggac
gtggcgcggctcctggcgagcacgggcgcgccgctgctggccaacatcta
cccctacttctcgtaccgcgacaacccgcgtgacatccagctcaactacg
cgacgttccggccgggcaccacggtgcgggacagcaagagcgggctgacc
tacacgaacctgttcgacgcgatggtggacgcggtgcacgcggcgctgga
gaaggcgggggcggcgagcgtgaaggtggtggtgtcggagagcgggtggc
cgaaggagggcgggaccggcgcgagcgtggacaacgcgagggcgtacaac
caggggctgatcgaccacgtcggtgggggcacccccaagaagcgcggcgc
gctggagacgtacgtgttcgccatgttcgacgagaaccagaagacggggg
ctgggacggagaagcacttcgggctgttcaacccggacaagtcgccggcc
taccccatccgcttctgatatcatcgatcatcgatctcgtaggtgtatat
tgtcgtccaaataagctgcacgtactgtaatgcggcagtattgaagtgtg
ccgggatacctacatcgtcagaataaagacaaagtcactaaaaaa
BLAST
BLAST Search