Query (optional)   in Class  

GrainGenes Sequence Report: AF158634

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AF158634
Subsequence
AF158634_1.cds6554008
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Aegilops ventricosa
Species
Aegilops ventricosa
Chromosome
2S
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
Triticum ventricosum Vrga1 (Vrga1) gene, complete cds.
Strain
11
Probe
csVrga1-3'
Gene
Vrga1
Gene Product
Vrga1
Remark
DB_xref: taxon:116981
Feature: source: mol_type = 'genomic DNA'; map = 'between PSR150 and PSR933'
Gene: Vrga1
EMBL Feature
feature_gene6554008Location: <655..>4008
DNA
cggggcaatggtgggctcacaccgcccgggtacacagccttggcgcggcc
cggaacgtgaaaaaaatcgcccggacgatggtgaagaggctggcgcgacg
aacctcttctcttttccggcggggaatgacctatctagtggtggtggccg
gtgggtggcgccgggatcgatagggtgcggccgagcgcgcgggggttggg
aggcgaatctggacggttggcttgacttttcgcctgacagtgtggtccag
gcgtgttttcccttgcgtcggagccccaagcgtccccggtgcaccaggtt
cggcctgctatcgccgggcccaaaaacgagtcgagccggcggatttcggc
gttttaggaacgcggctggagatgctttaagaggcagaggcagaatgggc
acggggagtagaacgggctcgcccgaaaacccgccaagatggcaggtaag
catcatgcttagctagaaagttaataatcgccaaaagcgtagcacttttt
gctacatcgtgtccacatctgagggagacggaggaggggatgctccatta
gctaagctctggtctgattacacgccattccattcaatactcgcttgctt
gggataggaggcatcggtggatccgcctccccctcgcccctcgcctccac
ccccatggatcttgtgctggaggaagccttgcgggccctggctcgcgcgg
tggaccagttccggagcctgggcgagaggcagatgcggaggtgcctgctg
ggcgccggggaccacgtcagcggcaagctgcgggaggtggcgacccagct
ggaccagatccgcggcctcctgtgggccgacgacgacaggagctctccgg
cgaggatggatcggctcaaggaggccctctacggcatcgacgatttggtc
gacgacatggagtaccacagcctcactttccaggttgaatccagtatttc
ctcaaagtcaaatcgcaatccactctcttctgctctcaggctgggcaagc
gattcgttagcggcggcggcggcggcggcgatgaggcgtcgcgctgccgg
ttcctcaaggatctcgattccgtcgcaagcactctcagctctctgctcaa
gcaagcacaagggtctggtctgccgcccgccgttccggtgccggattttg
acgcttccacgctgctccagggtggtcacaaggtgtttggccgcaacaag
gagctgaacgacatcgtgcagatgctggttgagccgccctcgccccactg
caccgcctgcaaggttgtctccattgttggcttcggtggtttgggcaaga
ccacgcttgcccagtcagtctacgacgacctcagagtcaagtcccacttt
gatctcagggcatgggcatatgtctccggcaagcctgacaaggtggaact
cgcaaagcaaatcttgcgttcagccaacccgagatacggtggatccatcg
acaaagatgccacgtttgcaactcttcagttgaagctcaatcggttaatg
tcgtccaagagatttctcattgttcttgatgatatctggggtgacgaccc
cttcaccaacgaggcctacaacgaaatcctcagtccactaagatccatgg
agagcggcagtaggattattgctgtcactcagacaccaaaggtggctggc
atgctagatgcatctcacacctactacctgaatgcattgggcgctgatga
ttgttggtcactgatcaaggaatctgcccttgggggctggagcacacatg
aggagtccactcaagaactggaacagatcgggaggaagattgccgccaag
ctcaacggattgcctctggctgccaagctcatgggaggactgcttggagc
tacaaagagcacaaagtactggcgtattatctcggaaaaagaattttccg
gagacatcactctctccttgctgcggttgagctacagttacctgccagga
cgactcaagcagtgctttgcgttctgcagcatatttcccaagaactggaa
gttcgaccaaacaaacttggtacgcctttggatggccaacggcttcattc
aaccgcaaagtggcactggcaaaaggatggaggatctgggcacagattat
ttcaatcttctgctgtctcggtccttcttccatgctctcaggcagggccg
tcgcacacactataagatgcatgacttgatccatgatatggcagtgtcag
cttcaaccgaagattgctgtcaaattgagcctggcatgacccgtcgtatc
ccctcaactgtgcgccatgtatcggtcaccacgggcagcttacaagacgt
caatgctgccatcaagatactcccaaaaaacctacgcactttcatagttt
ttggaaattggccacattttcttgaagatgactccctgggtaagctaaag
aatctgcgagcacttgatgtttgtcactgtgactttactgagttgccacc
agctatttcctgtttattccatctccgttacttgtcgctgtctcgcacca
ttcggagtcttccagagtccataagcaagctgctccatctgcaaaccttg
tgctttgaagataagtgttcccttgataagcttcctgcaggaataagtag
gcttgtaaagttgcggcaccttggaatcgacatgaagtacattgcacagc
taccgggcattggccggcttattaacctgcagggatcagttgagttccgt
gttgaaaaggggggagggcatgccttgcaagagctgaagggcataaaagg
tctccatggccagctaaaaattaaaggcctcgataatgtcttcagcaggg
atgaagccagcaagaccgacatgaaaagtaaagagaatcttagggcgctc
acactggaatggagttcagcttgtagatttctcacccctgtggctgattg
tgaagtactagaaaacctccagccacataaaaacttgaaggaacttagca
ttgtaaggtatcttggtgtgacatctcccagttggttacagatggcgttg
ctgagggagctgcaatccttgcaccttgttaactgcaggagcttgggagt
tctgcctgcactggggcttctgccatccctcgaacaattacatatgaagg
agctgtgcacggtcgagcgaattgggcatgagttctatggtactggtgac
atggcgtttccttccctaaaggttcttgtgcttgatgattttcccagctt
ggtcgagtggtctgaagtgagggaaaacccgcttccttgtctccagaggc
taaagattgtagactgccctaagttgattcaagttcctgcatttccgcca
tccgtctctgagcttacagtggagcgtacattattgatatctaatatgaa
gcttgctccttattcttcatcacgatcagagatactcaccctggacattt
ctacgactagtgtactttccaggggactgttccatcaaaggcatctagca
tctatcatagttttaaacataaacgctggctgcaagcatcttgttgccgc
agagggactccacacctttacttctctccaaaagcttcagctgtgccact
ctgacatatcagatcagaatttggaaagtcttcttcaggtgctgccctct
ttgtactcatttgagatgatagatctgcccaacatgacatctcttctggt
gccagcaaataatagtttgtgtacaacagtcacagagttgcaaatatcca
actgtccactgctctcttctgtattctccttgggtacttttgtttcacta
aaacatttggtgattgagaaatgccccaaactgacggcagcatctttccc
tgtaaacttttggagactcacagccctcaaggttctgagcatatcatact
gcacagagttccagtctttacctacttgtggtctgccaacctcaatagaa
gtacttcatcttgttgggtgtcacccaaagctgcatggaaattcaagcaa
caagactatcaattcccaagaggaagtttctactctacacaaaacattgg
ctcactgacagaacacacttcaggttttcccttagctgcctctctttctt
tccactgtactaccttcattgtgtaactttcacttcccttggttatttgc
tcctgtgtattagaaattatatgtgtgaaacatttcctgtgatgactcat
gcttattaccttgatgggaaataccctagcaccaaacaacctttattatt
tttgccaatcctgtagatgctgacatgtgcttttgatgtatgataattta
tgggttcaactgtgccttggtgcagattactgcccttgtaatttggttgt
gatttgatgttgcgtcccattgtttaagtttgttacattacacatacttc
agaattagtgcaatacacatgctggacagttgacatgcctatagtttact
attaccacttcttgccttttaacaagtgaagaacttaaaatatattattc
ctaaagcagcaaccgtttctataattcttttgagatagcttgttggtaca
tacctcggaaacaagttttcgctagtcccaatttcaggatggtaagagtt
tttttttaatctgatgtatcttttttgtgctgcaagcaggtgaaaaagga
ttggcaattgataaaaatggtaaacaagtgccgcatgaagaaatcaagtg
acgaaattctggttatataaggaaatagtatttgtcccgcaaaaataaaa
ataaggaaatagtatttggagtgcatatgaactgagtatgtgtcacaatg
tctaagcaatatttcattcgttgtctacaaaactatgaattctaggacat
gctattgtatcttttgttaaagggaatttgtaaagttgaattcatgaatt
attgtacattctcaggtttctttgt
BLAST
BLAST Search