Query (optional)   in Class  

GrainGenes Sequence Report: AF287722

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AF287722
Subsequence
AF287722_1.cds1664
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153928
NCBI UniGene
Hv.177
Data at Gramene
Gramene-Protein Q94G08
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Clone pFL834 1,4-beta-D xylan xylanohydrolase'
Species
Hordeum vulgare subsp. vulgare
Cultivar
Himalaya
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare clone pFL083 1,4-beta-D xylan xylanohydrolase mRNA, partial cds.
Clone
pFL083
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
DNA
ccgggaccgcctcggcgacgaggacgtcccggcgtacatgttcaaggagg
tggcgcggctggacccggagcccgtgctcttcgtcaacgactacaacgtg
gagtgcggcaacgaccccaacgcgacgccggagaagtacgccgagcaggt
cgcatggctgcagagctgcggcgcggtggtgcgcggcatcgggctgcagg
gccacgtgcaaaacccggtcggggaggtcatctgcgccgcgctcgacagg
ctcgccaagacgggggtgcccatctggttcaccgagctcgacgtgccgga
gtacgacgtgggcctccgcgccaaggacctggaggtggtgctccgggagg
cgtacgcgcacccggccgtggagggcatcgtgttctggggcttcatgcag
ggcacaatgtggcgccagaacgcttggctcgtcgacgccgatggcaccgt
caacgaggcgggccagatgttcctgaatctgcagaaggagtggaagacgg
acgcgcgggggaacttcgacggcgacgggaacttcaagttcaggggcttc
tacggcagatacgtcgtggaggttacgacggcgaagcggaagcagatgct
caatacctccacggtggagaaaggggacaacacacctgtcgtcgtggatt
tggctgacgcctgacggtgaatctatctaagaaactatttatttatacct
atctaattacatgcaacacgtcaagggataattggttgtataattttcac
atttctaaggtaacgggtattgtattttgtaagagaagtgtatggtgttt
gtactcctaaatctgatgaacatgattgaagcaaaatgcctattggtctt
aaaaaaaaaaaaaaa
BLAST
BLAST Search