Query (optional)   in Class  

GrainGenes Sequence Report: AF287726

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AF287726
Subsequence
AF287726_1.cds18223666
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153928
Data at Gramene
Gramene-Protein Q94G06
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Species
Hordeum vulgare subsp. vulgare
Cultivar
Igri
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare clone pFL699 1,4-beta-D xylan xylanohydrolase gene, complete cds.
Clone
pFL699
Gene Product
1,4-beta-D xylan xylanohydrolase
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'genomic DNA';
Note: plasmid pXYN-1
DNA
tcacagtctcctagaaaatggcgtcgcaccttaaattttctgcaatgaga
atcgtcctggataccaatacctttcatatatttaaattcagagtgggaag
atctccagaacaatatcagtcctagatacacttgaactattttggatttt
aatgttttgataatacttgaaatcactttttgtaaacattaaattgtata
aaagtgaaaactaacacatatctccattgagtcacccaaattctcaagat
gttgtgcatacgttttaggcatattttaattatgtaacacacactaaatt
ttagacacatattacaattattacataaaaaggaacgctattgtaattgc
gtaactcaagtttagaaaatacttttccgtttcaaaatataagacctttt
agagattttaatatgaactatatgcgaatgtatatagacatattttagcg
tgtacattcattcattttgttccgtatgtagtatatattgaaatctttaa
aaggcctgatatttaggaacggagggagtactacacatgtaatttaagca
gatgatgtttatttcatatatatttcgactatttcataattattttgcaa
tacaaaaatgataaaatggtgatttataaatagtgaacaatgcatgcatt
gtttatctttccaaaatcattatttcgtcatttccaaaatcaaaatttgc
acgtgcgtaatatacatccatataaacttattgatttttgtaagaatatt
ttgaaactcaaaaaatactattttgtcacttcaaaatatagtgctcactg
gaggtctggagttcttccttcaaggtgagtttttgattggacaccctcat
atttagtgtcacactttgactatgacaatttacggtgaggattctctttc
aaatacaaactcaatatttctcaaaaaatatttatgtagcatataaacta
caattcatttttgtatagatgatcaaggcttaacgcaaaacacgagggct
cctaatgcacccggaaaaaggaattacacggattgttatacccttctcat
tgttatatgccgtacgtagggtcatttaaaatgtacagtcttcttcatgc
acggtgtgttgcttgcttgccccgcaacgaacgattgcacgtactcctaa
atctgatgaatctgatgaacatgtttatgcgattgcttaacgtgattaga
cagatcgagctactctagtccctaggaggcaagagcaagattcgggaact
atcgtggtgtccatccatactggacgtgtggagccgttttctgtaacttg
aagccatgcattgcaagggcacgctcgaatttagcatgcaggaattagtt
acatcgtcgtcaccacaagtgagggcggctgcaagttcatgcaggaatta
gtaacatcgccgtcgaggaattaaatggtacgtgcgtgctctactaccac
gtctcgtttgggaaatcgtagcactcgccaggaaggtctcagcctttgtg
tgttgtgcaatcttcactgttactcaagagcagcaagcatgcgagagaga
gttcgttgcttccggtttgtgcctcgttcgttattgctcttcaccgttac
tctttccatcctgtgataacgactcgactatatccatctcgaattcccga
tcgactcaacgtcgccagccgccgccaaatttcgcccctttaaatacggt
ggccaccgtgatccatcatccctcactactcacacagcagagatcatcaa
tccgacgaacatcttcgcaacctccaggccagtctgctctcactagctag
tcactctcccactcgcgtaagatggcaagcacaactcaggtatgtaactt
gcatgcagctagcacaccatgagtccagctatagctcatttgcatggtgc
acttgtgtgctgcttgtttcaggacgtgaacatggacggcaacctcgccg
gctgcgtaccgttcggcacgggcacgacgacgctctccgtgcacatcgag
gaagagatggccatgcttcccgtcactgtggccgtgggtggcaacaagcc
cagcggccggtacgtcctcgtggctggccgcgccgacgaggaggacggcc
tgcgcctgccgatcccggtagacaccctgaagcctcgtctcacttaccgc
gtggccgggtggatcagcctgggagcagcacggggcaccagccaccccgt
gcgcatcgaccttggcgtggaagacaatggcaacgagaccctggtggagt
gcggcgcggtgtgcgccaaggagggcgggtggtcggagatcatgggcgcc
ttccggctcaggacggagccgcgcagcgccgcggtttacgtccacggcgc
ccccgccggcgtcgacgtcaaggtcatggatctccgcgtctacccggtgg
accacaaggcgcgcttcaggcagctcaaggacaagactgacaaggtgaga
gagcatgcatccacgtaataaccacctgcatgcacactcgcttgatgtgg
cacgtaacgtgatcatacgagctccattgatgcaggcgcgcaagagggac
gtgattctcaagctgggcacgccggcgggagcgggagcgggcgcggcggc
gtccgtgcgcgtggtgcagttggacaacgccttccccttcgggacatgca
tcaacacgtccgtcatccagaagccggccttcctcgacttcttcaccaac
cacttggactgggccgtcttcgagaacgagctcaagtggtaccacacgga
ggtgcagcagggccagctcaactacgccgacgccgacgcgctgctcgcgt
tctgcgaccgcctgggcaagaccgtccgcggccactgcgtcttctggtcc
gtggacggcgacgtgcagcagtgggttaagaacctcaacaaggaccagct
caggtccgccatgcagagccgcctcgagggcctcgtctcccgctacgccg
gcaggttcaagcactacgacgtcaacaacgagatgctgcacggccgcttc
ttccgggaccgcctcggcgacgaggacgtcccggcgtacatgttcaagga
ggtggcgcggctggacccggagcccgcgctcttcgtcaacgactacaacg
tggagtgcggcaacgaccccaacgcgacgccggagaagtacgccgagcag
gtcgcatggctgcagagctgcggcgcggtagtgcgcggcatcgggctgca
gggccacgtgcaaaacccggtcggggaggtcatctgcgccgcgctcgaca
ggctcgccaagacgggcgtgcccatctggttcaccgagctcgacgtgccg
gagtacgacgtgggcctccgcgccaaggacctggaggtggtgctccggga
ggcgtacgcgcacccggcggtggagggcatcgtgttctggggcttcatgc
agggaacaatgtggcgccagaacgcttggctcgtcgacgccgacggcacc
gtcaacgaggcggggcagatgttcctgaatctgcagaaggagtggaagac
ggacgcgcgggggaacttcgacggcgacgggaacttcaagttcaggggct
tctacggcagatacgtcgtggaggttacgacggcgaaggggaagcagatc
ctcaagaccttcagggtggagaaaggggacagcacacctctcgtcgtgga
tttggccgacgcctgacggtgaatctatctaagaaactatttatttatac
ctatctaattacatgcaacacgtcaagtgataattggttgtataattttc
acatttctaaggtaacgggtattgtattttgtaagagaagtctaaggtat
ttgtactcctaaatctgatgaacatgattgaagcaaaaggcctattggtg
ttgctagcaaataattatgactcaatatcgtgacatatgaacatcttcta
ttttaacactgtggctcatcatgttgccatttatttttctttccaccctc
gttgatgatggtgtgatgttcacatgatcataatgcattcgacatgataa
atcccaaggctatgagcttttcactgcacgctacactttccattatattg
tgcaaggaattgtttaaaactttttaaaaaatctcaacgaccacgaacta
cttccaatgcctagacatataaagactttcaaaaaactaatcaaatccta
gacatagttcttttgaatcggtgaacggtttttcgaaccgacaaacattg
ttttcaaattttgtatttttcaaaaaaaaatcatgaacagtttgaaatgc
atgatcagttttcgaattcatgaatattttcttactcatcaacgtttttg
aattgatcaacttttttcaaacaaattctgaataaattttaaaaacatgt
gttttttaatttatgtcaatattttctaaaatttcatggccatttgtttt
cagattccttaatacattttgaatacactatcattttttcaaaagcatga
acacggttttgtttcttgaccattttttccaaatcacgaatattttttat
aattggtgaacaatattgcaaaactatcaacattttttaatccacaaaaa
ttatgatttccttaaaatgttttgaattcacatacactttatgatttctc
gaacatctttttgaaaacccacaacttttgaaattttaaaatcgaatttg
tggaaagaaggaaaagaaaacagaatgagaaaagaaaagacagaaaaatt
aaatagcgcagtcgagccttgcacatgggccggtccattaacgcttatgc
ggggatgatttgctgaaggaaaggaagagaaaagagatggagactgggat
tcaatcctttgtctcaaaggtaataacgctagacgctaaccactccacta
cttgggcgtttgtgctttgcgtcagtattgtttttataaaacaacgtaac
acgacgcaactttgcaacaacggacgacagaagcactttgtgctttagta
ttagggatagattttatagaatatatatacccatgatgtttatggatttt
ttttgtctaaaatgaccacctactcaaccaaattgctaaaaaaaccactt
ttggataaaattgatagacaagacccctgatcgtggcggcaggtgcaccg
gccgagatgtcgcacctgctgccacggacggaggcggcaaccctgttcac
atgactgtttatgcgagggactgtttactaaagatgaacaatatttaaaa
aaaatcaaaaaatagcagagaaattaaaaaaaaactgaatttttttggca
agaaagatgatcgattgttctagctgggtttgaaatttcaatcttttatg
ttttttctttttatatttttttttcaaaaatactgtttattttgggtgaa
caataatgtcgctgcgtcggagtgaacagtgctgccgtctctaggcgtgg
cggcaggtgccacctgtcagctggcgcgcctgtttccatggccgaggagg
ccttttttgttaatttcatctaga
BLAST
BLAST Search