Query (optional)   in Class  

GrainGenes Sequence Report: AF309354

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AF309354
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Hordeum vulgare
Keyword
STS
Species
Hordeum vulgare
Chromosome
1H
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare STS marker ABC152, sequence tagged site.
Probe
ABC152
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'genomic DNA'; map = '1H centromeric region';
Feature: STS: standard_name = 'ABC152';
Locus Comment: forward ACAAGGAAAGCCAATCAAC, reverse CCGCAAGTACCAGAAGAGC.
Note: putative map location; sequence was previously used as a probe to map an RFLP locus on barley chromosome 1H (Kleinhofs et al, 1993. A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genom e). In our paper (Collins et al., 2000), we did not test the genomic locations of the PCR-amplified DNA fragment genotype: BCIngrid mlo-5
EMBL Feature
STS1334partial sequence of a transcribed geneLocation: <1..>334
DNA
caaggaaagccaatcaactacactaatactaatgctggcgaacggtgtca
tcgctcccgaatgcagcgctctgggtggcttaggcgcgctccccgcggat
gcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgt
ggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcg
gcggcctcctggagggccagcacggcgtgggactggaacctgaggtcggt
cttgaagtcctgcgcgatctccctcaccaggcgctggaacgggagcttgc
ggatcagcagctcggtgctcttctggtacttgcg
BLAST
BLAST Search