Query (optional)   in Class  

GrainGenes Sequence Report: AF480485

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AF480485
Subsequence
AF480485_1.cds12508
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Aegilops tauschii
Species
Aegilops tauschii
Chromosome
1
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
Aegilops tauschii high molecular weight glutenin subunit (1Dx2t) gene, partial cds.
Strain
RM0198
Gene
1Dx2t
Gene Product
high molecular weight glutenin subunit
Remark
DB_xref: taxon:37682
Feature: source: mol_type = 'genomic DNA'; map = '1D'
Gene: 1Dx2t
EMBL Feature
feature_gene12508Location: <1..>2508
DNA
atggctaagcggttagtcctctttgtggcggtagtcgtcgccctcgtggc
tctcaccgtcgctgaaggtgaggcctctgagcaactacagtgtgagcgcg
agctccaggagctccaggagcgcgagctcaaggcatgccagcaggtcatg
gaccagcagctccgagacattagccccgagtgccaccccgtcgtcgtcag
cccggtcgcgggacaatacgagcagcaaatcgtggtgccgcccaagggcg
gatctttctaccccggcgagaccacgccaccgcagcaactccaacaacgt
atattttggggaatacctgcactactaaaaaggtattacccaagtgtaac
ttctccgcagcaggtttcatactatccaggccaagcttctccgcaacggc
caggacaaggtcagcagccaggacaagggcaacaatcaggacaaggacaa
caagggtactacccaacttctccgcaacagccaggacaatggcaacaacc
ggaacaagggcaaccagggtactacccaacttctccgcagcagccaggac
aattgcaacaaccagcacaagggcagcaaccaggacaagggcaacaaggt
cagcagccaggacaagggcaaccagggtactacccaacttcttcgcagct
gcagccaggacaattgcaacaaccagcacaagggcaacaagggcagcaac
caggacaagggcaacaaggtcaacagccaggacaagggcaacaaccagga
caaggacaacaaggtcaacagccaggacaagggcaacaaccaggacaagg
gcaacaaggtcagcagctcggacaaggacaacaagggtactacccaactt
ctctgcaacagtcgggacaagggcaaccagggtactacccaacttctctg
cagcagctaggacaagggcaatcagggtactacccaacttctccgcagca
accaggacaagggcagcagctaggacaattgcaacaaccagcacaagggc
agcaaccaggacaagggcaacaaggtcagcagccaggacaagggcaacaa
ggccagcagccaggacaagggcagcaaccgggacaagggcaaccagggta
ctacccaacttctccgcagcagtcaggacaagggcaaccagggtattacc
caacttcttcgcagcagccaacacaatcgcagcaaccaggacaagggcaa
caaggtcagcaggtaggacaagggcaacaagctcagcagccaggacaagg
gcagcaaccgggacaagggcagccagggtactacccaacttctccgcagc
agtcaggacaagggcaaccagggtactacctaacttctccgcagcagtca
ggacaagggcagcagccaggacaattgcaacaatcagcacaagggcaaaa
aggacagcaaccaggacaaggtcaacagccagggcaagggcaacaaggtc
agcagccaggacaagggcaacaaggtcagcaaccggggcaagggcagcca
gggtactacccaacttctccgcagcaatcaggacaagggcaacagccagg
acaatggcaacaaccaggacaagggcaaccaggatactacccaacttctc
cgttgcaaccaggacaagggcaaccagggtacgacccaacttctccgcaa
cagccaggacaagggcagcaaccaggacaattgcaacaaccagcgcaagg
gcaacaagggcagcaactagcacaagggcaacaaggtcagcagccaggac
aagggcaacaaggtcagcagccaggacaagggcaacaaggtcagcagcca
ggacaagggcaacaagggcagcagccagcacaagggcaacaaggtcagca
gccaggacaagggcaacaaggtcagcagccaggacaagggcaacaaggtc
agcagccaggacaagggcagcaaccgggacaagggcagccatggtactac
ccaacttctccgcaggagtcaggacaagggcaacagccaggacaatggca
acaaccaggacaagggcaaccagggtactacctaacttctccgttgcagc
taggacaagggcagcaagggtactacccaacttctctgcaacaaccagga
caagggcagcaaccaggacaatggcaacaatcgggacaagggcaacatgg
gtactacccaacttctccgcagctgtcaggacaagggcaacggccaggac
aatggctgcaaccaggacaagggcaacaagggtactacccaacttctccg
caacagtcaggacaagggcaacaactaggacaatggctgcaaccaggaca
agggcaacaagggtactacccaacttctctgcaacagacaggacaagggc
agcaatcaggacaagggcaacaaggctactacagctcataccatgttagc
gtggagcaccaggcggccagcctaaaggtggcaaaagcgcagcagctcgc
ggcacagctgccggcaatgtgccggctggagggcggcgacgcattgtcgg
ccagccag
BLAST
BLAST Search