Query (optional)   in Class  

GrainGenes Sequence Report: AJ006098

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AJ006098
Subsequence
AJ006098_1.cds72512
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC359098
Data at Gramene
Gramene-Protein O64392
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
pathogenisis-related protein
wheatwin1 protein
wPR4a gene
Species
Triticum aestivum
Cultivar
S. Pastore
Clone Library
lambda gt11.8
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum wPR4a gene.
Gene Product
wheatwin1
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA'; tissue_lib = 'endosperm'
Gene: wPR4a
EMBL Feature
mat_peptide135509Location: 135..509
polyA_signal560566Location: 560..566
polyA_signal606612Location: 606..612
sig_peptide72134Location: 72..134
feature_gene72612Location: 72..612
DNA
gaattcgcggccgcgtcgaccacaaactagctagcaggttgtgactgatc
accgtggtcgacgagacgacgatggccgcacgcccgatgctggtggtggc
gctgctgtgcgcggcggcggcggcggccacggcgcagcaggcgaccaacg
tgcgggcgacgtaccactactaccggccggcgcagaacaactgggacctg
ggcgcgcccgcggtgagcgcctactgcgcaacctgggacgccagcaagcc
gctgtcgtggcggtccaagtacgggtggacggcgttctgcggccccgccg
gcgcccacgggcaggcgtcctgcggcaagtgcctccaggtgaccaacccg
gcgacgggggcgcagatcacggcgaggatcgtggaccagtgcgccaacgg
cgggctggacctggactgggacaccgtcttcaccaagatcgacaccaacg
ggatcgggtaccagcagggccaccttaacgtcaactaccagttcgtcgac
tgccgcgactagattacgttctccgtcgatcgatcaaagggctagctagc
tatgataagaataaaaggctagctaaaagtaagttgagactgatccatgc
tgtttaataaaagctagcacgggatgctgccttgtatacgtgttacgtgt
ccccagtacgtacatggacccaaataaagtggaaaagaccaaacgggtta
tctattcaaaaaaaaaaaaaaaaaaaaaaaagggacgcgttccgcgaatt
c
BLAST
BLAST Search