Query (optional)   in Class  

GrainGenes Sequence Report: AJ234546

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AJ234546
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
RFLP marker
Species
Hordeum vulgare subsp. vulgare
Cultivar
Igri
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare genomic DNA fragment; clone MWG0632.
Clone
MWG0632
Probe
MWG632
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'genomic DNA';
EMBL Feature
misc_feature1703vector: pBluescriptLocation: 1..703
DNA
aaagtaaatgagaactttaattacaaggatggaatgaagtgaggtgggtc
tcgtcaaacaaacacttaacaaacacttaacaaaggaaagctgaaaatca
cgcagaaagctggtgagcatgatgcgcacctgtgcagaatctgagatcaa
cagcagcacaaggtcgctgcctgaaactgtctcccatatgtcccccaatg
ttccgtcctcctcagtgaatccagcaccacgtgcttcctcaaaagacttg
gaacctttcctgagaccaatctgaaaccmaaaagacacagcctatttgaa
caactgacatttatactgccaaagtacatactaccaaatggcgcagaata
taagctgtcacataatttgcatattccaatttgtatagcaccaaattttc
actttaagcaagaacaagtgataaaacagtgcccggtgcaagttattata
aagctgaagaaaacaataaacattagctgtgggtgttcactcagggctgc
aagcmaaagcttcagaactttttcacttaacagacagtgaaaactcaatc
ccatgtctgaagctggatactactacatgaggatagctaaccttgacgac
gatgtcagacttggcttccaccaaggaatccctcaggttctgggcctgcg
ccggaccctgcaaaagcaccatgagaaatctctattagagccagcgcacg
gac
BLAST
BLAST Search