Query (optional)   in Class  

GrainGenes Sequence Report: AJ246140

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AJ246140
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: oat root associated euascomycete 0001
Keyword
18S ribosomal RNA
[ Show all 8 ]
Species
oat root associated euascomycete 0001
Data Source
genbankDownloaded 2008-2009
Title
oat root associated euascomycete 0001 5S rRNA and partial 18S rRNA genes and ITS1 and 2, isolate 0001.
Strain
OOO1
Gene
18S rRNA
5.8S rRNA
Gene Product
5.8S ribosomal RNA
18S ribosomal RNA
Remark
DB_xref: taxon:97957
Feature: source: mol_type = 'genomic DNA';
Note: isolated from Avena sp. roots (oat)
EMBL Feature
[ Hide all but 1 of 6 ]
misc_feature113345internal transcribed spacer 1, ITS1Location: 113..345
misc_feature505638internal transcribed spacer 2, ITS2Location: 505..638
feature_gene1112Location: 1..112
feature_gene346504Location: 346..504
rRNA1112
rRNA346504
DNA
agagagggtggcaacacccactcagggctggaaaatcgtacaaacttggt
catttagaggaagtaaaagtcgtaacaaggtttccgtaggtgaacctgcg
gaaggatcattactagagcaaaggatagacagcgcccgcggagcttgctc
cctggggctaccctacttcggtagggtttagagtcgtcgggcctctcgaa
gaagctcggtcctgaactccacccttgaataaattacctttgttgctttg
gcgggccgcctcgtgccagcggcttcggctgttgcgtgcccgccagagga
ccacaactcttgtttttagtgatgtctgagtactatttaatagttaaaac
tttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaa
tgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttga
acgcacattgcgccctctggtattccggggggcatgcctgttcgagcgtc
attataaccactcaagctctcgcttggtattggggttcgcggtctcgcgg
cccctaaaatcagtggcggtgcctgtcggctctacgcgtagtaatactcc
tcgcgattgagtccggtaggtttacttgccagcaaccc
BLAST
BLAST Search