Query (optional)   in Class  

GrainGenes Sequence Report: AJ249144

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AJ249144
Subsequence
AJ249144_1.cds141875
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC161883
NCBI UniGene
Hv.23025
Data at Gramene
Gramene-Protein Q9LEI2
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'BM5a'
Keyword
m5 gene
MADS-box protein 5
Species
Hordeum vulgare subsp. vulgare
Cultivar
Atlas
Clone Library
lambda NM1149
Tissue
inflorescence
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare mRNA for MADS-box protein 5 (m5 gene).
Strain
vulgare
Probe
AJ249144
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Gene: m5
EMBL Feature
feature_gene11196Location: 1..1196
DNA
ctctcccctcccacttcacccaaccacctgacagccatggctccgccacc
tcgcctccgcccgcgcctctgagagtagccgtcgcggtcgctcgctcgct
cgctcgctgctgccggtgttggcccggtcctcgagcggagatggggcgca
ggaaggtgcagctgaagcggatcgagaacaagatcaaccgccaggtcacc
ttctccaagcgccgctcggggctgctcaagaaggcgcacgagatctccgt
gctctacgacgccgaggtcggcctcatcatcttctccaccaagggaaagc
tctacgagttctccaccgagtcatgtatggacaaaattcttgaacggtat
gagcgctactcttatgcagaaaaggttctcgtttcaagtgaatctgaaat
tcagggaaactggtgtcacgaatataggaaactgaaggcgaaggttgaga
caatacagaaatgtcaaaagcatctcatgggagaggatcttgaatctttg
aatctcaaggagttgcagcaactggagcagcagctggaaagctcactgaa
acatatcagagccaggaagaaccaacttatgcacgaatccatttctgagc
ttcagaagaaggagaggtcactgcaggaggagaataaagttctccagaag
gaacttgtggagaagcagaaggcccaggcggcgcagcaagatcaaactca
gcctcaaaccagctcttcttcttcttccttcatgatgagggatgctcccc
ctgtcgcagataccagcaatcacccagcggcggcaggcgagagggcagag
gatgtggcagtgcagcctcaggtcccactccggacggcgcttccactgtg
gatggtgagccacatcaacggctgaagggcttccagcccatgtaagcgta
ctattcagtacgagtaacaagttgcagcggccagcctggtgtatcatgcg
gttgcgaacatgctaaccccatggaggggagaggaaaagaaatcagagta
aagcagcaagctgcaggaatgtgtatatttcacttcgtccacctcagttt
cctttccacctgggctgagatggctgtacgagtaatctaccatgtaattt
atatgtagcatgagtgacgaattttcaactttcgatgatatccgttgctc
ctgggtgttgtttctgtgaattaacctatcgaatatgagcgttgtg
BLAST
BLAST Search