Query (optional)   in Class  

GrainGenes Sequence Report: AJ271367

[ Submit comment/correction ]

Sequence
AJ271367
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
NCBI UniGene
Hv.18110
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title '1,3-beta glucan endohydrolase precursor'
Keyword
beta-1,3-glucanase
Species
Hordeum vulgare subsp. vulgare
Cultivar
Pallas
Developmental Stage
first leaf , 3 days after innoculation with Blumeria (syn.Erysiphe) graminis C15
Data Source
genbankRelease 135, Apr 15 2003
Title
Hordeum vulgare mRNA for beta-1,3-glucanase.
Probe
BH72-11
Remark
DB_xref: taxon:112509
Feature: 5'UTR: gene = 'beta-1,3-glucanase'; evidence = experimental
Feature: source: mol_type = 'mRNA'; country = 'Denmark';
Gene: beta-1,3-glucanase
Note: near isogenic line P-02 (carrying resistance gene M1-a3)
EMBL Feature
polyA_signal12111217Location: 1211..1217
feature_gene11257Location: 1..1257
5_UTR741055Location: 74..1055
DNA
ccgcagcattgcatagcatttgagcaccagatactccatgtgtgcagcaa
tggctagaaaagatgttgcctccatgtttgcagctgctctcttcattgga
gcgttcgctgctgttcctacgagtgtgcagtccatcggcgtgtgctacgg
cgtgatcggcaacaacctcccctcccggagcgacgtggtgcagctctaca
ggtccaagggcatcaacggcatgcgcatctacttcgccgacgggcaggcc
ctctcggcgctccgcaactccggcatcggcctcatcctcgacatcggcaa
cgaccagctcgccaacatcgccgccagcacctccaacgcggcctcctggg
tccagaacaacgtgcggccctactaccctgccgtgaacatcaagtacatc
gccgccggcaacgaggtgcagggcggcgccacgcagagcatcctgccggc
catgcgcaacctcaacgcggccctctccgcggcggggctcggcgccatca
aggtgtccacctccatccggttcgacgaggtggccaactccttcccgccc
tccgccggcgtgttcaagaacgcctacatgacggacgtggcccggctcct
ggcgagcaccggcgcgccgctgctggccaacgtctacccctacttcgcgt
accgtgacaaccccgggagcatcagcctgaactacgcgacgttccagccg
ggcaccaccgtgcgtgaccagaacaacgggctgacctacacgtccctgtt
cgacgcgatggtggacgccgtgtacgcggcgctggagaaggccggcgcgc
cggcggtgaaggtggtggtgtcggagagcgggtggccgtcggcgggcggg
tttgcggcgtcggccggcaatgcgcggacgtacaaccaggggctgatcaa
ccacgtcggcgggggcacgcccaagaagcgggaggcgctggagacgtaca
tcttcgccatgttcaacgagaaccagaagaccggggacgccacggagagg
agcttcgggctcttcaacccggacaagtcgccggcatacaacatccagtt
ctagtacgtgtagctacctagctcacatacctaaataaataagctgcacg
tacgtacgtaatgcggcatccaagtgtaacgtagacacgtacattcatcc
atggaagagtgcaaccaagcatgcgttaacttcctggtgatgatacatca
tcatggtatgaataaaagatatggaagatgttatgaaaaaaaaaaaaaaa
aaaaaaa
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.