Query (optional)   in Class  

GrainGenes Sequence Report: AJ409199

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AJ409199
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Secale cereale subsp. ancestrale
Keyword
18S ribosomal RNA
[ Show all 10 ]
Species
Secale cereale subsp. ancestrale
Data Source
genbankRelease 136, Jun 15 2003
genbankRelease 137, Aug 15 2003
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
Secale cereale subsp. ancestrale 18S rRNA gene, 5.8S rRNA gene, 26S rRNA gene, internal transcribed spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2), clone pAHSca2.
Strain
ancestrale
Clone
pAHSca2
Gene
18S rRNA
5.8S rRNA
26S rRNA
Gene Product
5.8S ribosomal RNA
26S ribosomal RNA
18S ribosomal RNA
Remark
DB_xref: taxon:155089
Feature: source: mol_type = 'genomic DNA';
Gene: 18S rRNA
Gene: 5.8S rRNA
Gene: 26S rRNA
EMBL Feature
misc_feature55276internal transcribed spacer 1, ITS1Location: 55..276
[ Show all 8 ]
DNA
ggaaggagaagtcgtaacaaggtttccgtaggtgaacctgcggaaggatc
attgtcgtgaccctgaccaaaacagaccgcgcacgcgtcatccaatccgt
cggtgacggcaccgtccgtcgctcggcctatgcctcgaccacctcccctc
cacggagtgggtgggggctcgaggcaaaagaacccacggcgccgaaggcg
tcaaggaacactgtgcctaacacggggccatggctagcttgctagctgtg
actcgtgttgcaaagctatttaatccacacgactctcggcaacggatatc
tcggctctcgcatcgatgaagaacgtagcgaaatgcgatacctggtgtga
attgcagaatcccgcgaaccatcgagtctttgaacgcaagttgcgcccga
ggccactcggccgagggcacgcctgcctgggcgtcacgccaaaacacgct
cccacacccctcattgggaatcgggatgcggcatctggtccctcgtctcg
caaggggcggtggaccgaagttcgggctgccggcgtaccgtgtcaaacac
agcgcgtggtgggcgtctttgctttatcaacgcagtgcatacgacgcgta
gccggcatgatggcctcaaaacgacccaacaaacgtagcgcacgtcgctt
cgaccgcgaccccaggtcaggcgggactgcccgct
BLAST
BLAST Search