Query (optional)   in Class  

GrainGenes Sequence Report: AJ564996

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AJ564996
Contig
Ta.199.1.S1_at
Subsequence
AJ564996_1.cds711861
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC277129
NCBI UniGene
Ta.199
Data at Gramene
Gramene-Protein Q70LR2
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Fructan 1-exohydrolase'
Keyword
1-FEH w3 gene
fructan 1-exohydrolase w3
Species
Triticum aestivum
Cultivar
Pajero
Data Source
genbankRelease 140, Feb 15 2004
genbankDownloaded 2008-2009
Title
Triticum aestivum mRNA for fructan 1-exohydrolase w3 precursor (1-FEH w3 gene).
Gene
1-FEH w3
Gene Product
fructan 1-exohydrolase w3
Remark
DB_xref: taxon:4565
[ Show all 7 ]
EMBL Feature
mat_peptide2241858Location: 224..1858
sig_peptide71223Location: 71..223
feature_gene12108Location: 1..2108
DNA
cacacccgcttgctccttatcacctcccacctcactcccactcctcccct
ctctcccccctcctgccgccatggcccaagcttgggccttcctcctcccg
gtcctcgtcctcggctcctacgtaaccagcctcttcctccccacctatat
aaccggccccctctgcggcggcgatggaggaggcagatccttgttcctct
gcgcgcaggctcccaaggaccaggacccgtctcctgccagcaccatgtac
aagaccgccttccacttccagcccgccaagaactggatgaacgatccatc
tggaccaatgtacttcaatggcatctaccatgaattctaccagtataacc
tcaacggccccatttttggtgacatagtttggggccattcggtttcaaca
gaccttgtcaactggatcgggcttgaacccgcgttagtgcgggacacccc
tagtgacatagacggctgctggaccggctcagtcaccattctgcctggtg
gtaaaccgatcatcatatacactggtggtgacatagatcaaaatcaggca
caaaacatcgcgtttccgaaaaaccggtctgacccatacctgagggaatg
gatcaaagcagacaataacccggtgctccgaccggacgaaccagggatga
actcgatcgagttcagggatccgacaaccggttggatcggaccggatgga
ctgtggaggatggcagttggtggtgagctgaacggctacagtgctgcgct
tttgtacaagagtgaagactttctgaattggacaaaagttgatcacccac
tgtattcacataatggatccaatatgtgggagtgtccggatttctttgcg
gtattgccgggcaataacgctggactggacctgtccgcagcgatcccaca
aggcgccaagcatgccctcaaaatgagcgtggattcagttgacaagtaca
tgatcggggtgtatgatctccatcgtgatgcctttgtgccagataatgtc
gtagatgaccgtcggctgtggctgagaatagattacggcactttctatgc
ttcaaaatcattctttgactcgaacaagaacaggaggatcatatggggtt
ggtctagggagacagatagtccttcagatgatcttgcaaaaggttgggca
ggactccatacaatccccaggacaatttggttagccggcgatggcaagca
gttgttacaatggccagttgaggagattgagtcccttcgaacaaatgaaa
tcaaccatcaaggactagagctcaacaagggagatctatttgagatcaag
gaagttgacgcttttcaggctgatgtagagataggttttgagctggcgtc
catcgatgacgccgatccttttgatccttcctggcttttggaccctgaga
agcattgtggggaagcgggtgcatcagttcctggtggtataggtccattt
ggacttgtcattctggcctccgacaacatggacgagcacactgaggtgta
tttcagagtctacaagtcacaggaaaagtacatggtactcatgtgctctg
atctaagaaggtcttccctgagaccagatctggagaaaccagcctatgga
ggcttctttgaatttgatcttgaaaaggaaaggaagatatcactcagaac
tctgattgaccggtcggcggtggagagcttcggtggcggtggcagggttt
gcatcacatccagagtttatccggcggtgctggccgacgtcggcagtgcc
cacatttacgctttcaacaatggaagtgccacggtcagggtgccacagct
cagcgcatggaccatgaggaaggcacaagtgaatgtggagaagggttgga
gtgctatttaaaacagaggagcaatttgattttctcgattcttttactat
cattcatcagcattgcctggcagaaataaggacattcagcaggaaagaaa
atagcctatcatttctttgatctctagtattcatatattgtagttactac
ttagtaagcccttcccatctcagttacttgtatcaatttttatggaaacg
cacactagtgatgaaattcacgggatgagtactttagtcaaaaaaaaaaa
aaaaaaaa
BLAST
BLAST Search