Query (optional)   in Class  

GrainGenes Sequence Report: AJ577386

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AJ577386
Contig
Ta.100.1.S1_at
Subsequence
AJ577386_1.cds1676
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC293066
NCBI UniGene
Ta.100
Data at Gramene
Gramene-Protein Q70JP8
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'HALF-1'
Keyword
HALF-1 transcription factor
Species
Triticum aestivum
Cultivar
Chinese Spring
Tissue
spike at heading stage
Data Source
genbankRelease 140, Feb 15 2004
genbankRelease 145, Dec 15 2004
Title
Triticum aestivum partial mRNA for putative HALF-1 transcription factor.
Clone
F44-B
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
EMBL Feature
3_UTR677905Location: 677..905
DNA
tgacactgaccaaaaggattcgtctgcacctaagaagaggaaatctggta
atacctcagcggaaggtgaaccgtctcaagctgctgctgttccatatgct
gctgtcgagtcaccgtatcagttgaaggggaggtctgcctcaaagcttcc
agtttctgcscctgggcgggcagcacttcccaatgccacgccaaatctga
acatagggattgatctttggagtgcttctcaatccttagctgtgatccca
gtgcagggggaagcaaatcctgggttggcgcttgcccgatgtgatggtgt
tggtcagctggatgagcgtgaaattaagagggagaggcgaaaacaatcta
atagggagtctgcgaggagatcaaggttacgcaagcagcaagagtgcgag
gaattatcgaggaaggttgctgagctgacaacagagaacaacgccctcag
aactgagcttgaccagcttaagaaggcctgtgaagatatggaagcacaga
atgcacaactaatgtctcaggaacctgccgcggtcacaaccacactgggc
atgagcatcgcagcgcccaaagtgcagcatcacgatgatgagggtaagct
tcataagaaggctaataataacagcaacgggaagtacgtaggtggcagcc
acaaactggaggctaaccctaggtgagagaccccacgagggagtgacaga
gatgagatgtggtgttcctttatctaaccacaacacccatcatcgattca
gtgtgcttttagcaaagatgatgttttagtccacttctcacagctcaccg
ggggccctgtagagttgccccgtcgcagccatgtattatttgtggctcgt
tgccgagaagaatgtgtaaactgattggtgtacctagagccttagaaatt
ttatg
BLAST
BLAST Search