Query (optional)   in Class  

GrainGenes Sequence Report: AJ583446

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AJ583446
Subsequence
AJ583446_1.cds821536
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC155271
NCBI UniGene
Hv.20713
Data at Gramene
Gramene-Protein Q70EZ8
DB Remark
Locus Source: plastid Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf162k16, mRNA sequence'
Keyword
1-deoxy-D-xylulose 5-phosphate reductoisomerase
dxr gene
Species
Hordeum vulgare subsp. vulgare
Cultivar
Salome
Clone Library
lambda UNIZAP-XR
Tissue
mycorrhizal roots
Data Source
genbankRelease 138, Oct 15 2003
genbankRelease 141, Apr 15 2004
genbankRelease 145, Dec 15 2004
Title
Hordeum vulgare plastid mRNA for putative 1-deoxy-D-xylulose 5-phosphate reductoisomerase (dxr gene).
Strain
vulgare
Gene Product
1-deoxy-D-xylulose 5-phosphate reductoisomerase
Remark
DB_xref: taxon:112509
[ Show all 7 ]
EMBL Feature
mat_peptide2591533Location: 259..1533
transit_peptide82258Location: 82..258
feature_gene11800Location: 1..1800
DNA
gcctccactatctcctcccattcttgctctcgtctccacgcgtcggcaca
gagcagagcagggtcgtcggcggcgatatcgatggcgctcaaggcctcct
tttccggcgagctcgccggtgccccctccctcctcgactccggctccgtc
agcagcaggggaggggccgccttccgccaccgccagcgccagcgatgcaa
agtggacttcacgtttcaaaggagggacaagagagcagtctacctgacaa
ggacatgctgctctatgcagcagggcccgccgcccgcctggcccggccga
gccgtcgtggaacccgggaggaggtcgtgggagggccccaagcccatctc
catcgtcggttcaactggttccatagggacacaaacattggacatcgtcg
cggagaatcctgataagttccgggttgttgctctagctgctggctccaat
gtcactcttctagctgatcaggtgaaaacgttcaaaccaaagctggttgc
gctaagggacgagtcattacttaacgagctaaaggaagcgttagctggtt
gtgaggagatgccggaaattattcctggggagcaaggtgtcatagaggtt
gctcgccacccagatgcagttacagtcgttaccggcatagtagggtgtgc
aggactcaagcctacagttgcagcaattgaagctgggaaagacatagcac
tggcgaacaaggagacacttattgcaggcggcccgttcgtgcttcccctt
gcgcacaagcacaatgtgaaaatacttcctgctgattcagagcactctgc
aatatttcagtgtatacaaggcttgtctgaaggatcacttcgtcgtgtta
tcctgactgcgtctggcggtgctttcagggactggccagtagagaagctg
aaagacgtaaaggttgccgatgctttgaagcacccaaattggagcatggg
gaagaaaatcacagtagattctgctactttattcaacaaggggttagaag
ttatcgaggcacattatttgtttggtgctgaatatgatgacattgacatt
gtgattcacccgcaatccatcatacactccatgattgaaacccaggattc
atctgtcctggcgcagctgggatggccagacatgcggctaccgatcctat
acaccttatcctggccggacagagtctattgctccgaggtcacctggccc
cggctagacctttgcaagctgggttcgctgacattcaaagctcccgacaa
cgtgaaatacccatcggtggatcttgcgtacgcagcagggcgagccgggg
gcaccatgacaggagttttgagtgctgctaatgagaaggcggtggagctg
ttcatcgacgaaaagatcagctacctggatatcttcaaggtggtggagat
gacatgcgacgcgcaccgcaacgagctggtgacaagcccgtcgctcgagg
agatcatacattacgaccagtgggcgaggaagttcgccgccaacctacag
ccatcgtcatctggacggagccctgtgctcgcctaaggccctgtttggaa
caagggacgtttgtgtgcacggttcttcccggagcctgccaatgaagcat
acaagatgtacactactcctcccatggcctgaccttggtaaaattggtca
tgtggaaatcaagcttagatatttcaacgggcatacataggttgccttcc
tgaaatgtaaatcatgtgtttgcatgaataaatcatgtataattttgatg
gatggattgatgaaagaaatagggaagactcaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search