Query (optional)   in Class  

GrainGenes Sequence Report: AK251033.1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AK251033.1
Locus
AK251033.1
DNA
GAGCCTCCTCCGCCCACTCCCAGCCTCGCCTCGCCGCCACACTCCCCACT
CCCACTGCGCTGCTCCGTCGAGCCAGCTCGCTGATCAGAGAAGATGAGGG
AGATCCTCCACATTCAGGGTGGTCAATGTGGAAACCAGATTGGTTCCAAG
TTCTGGGAGGTGGTTTGTGACGAGCATGGCATCGACCCCACTGGGCGGTA
TGTCGGCACCTCTGACCTGCAGCTGGAGCGTGTCAATGTCTACTATAATG
AGGCCTCATGCGGCCGCTTTGTGCCCCGGGCTGTTCTTATGGATCTGGAG
CCTGGTACTATGGACAGTGTTCGTACTGGACCATACGGGCAGATCTTCCG
CCCTGACAACTTCGTGTTTGGGCAGTCTGGTGCTGGTAACAATTGGGCCA
AGGGTCATTACACCGAGGGTGCAGAGCTCATTGACTCTGTTCTTGACGTT
GTCAGGAAGGAGGCTGAGAACTGTGACTGCCTTCAAGGTTTCCAAGTATG
CCACTCTCTTGGTGGTGGTACTGGATCAGGCATGGGGACACTTTTGATAT
CAAAGATCAGGGAGGAGTACCCAGACCGCATGATGTTAACATTCTCTGTT
TTCCCTTCACCGAAAGTATCTGATACTGTGGTTGAGCCTTACAATGCCAC
TCTTTCGGTCCATCAGTTGGTTGAGAATGCAGATGAGTGCATGGTTCTTG
ACAACGAGGCCCTTTATGACATCTGTTTCAGGACTCTTAAGCTGACCACT
CCCAGCTTTGGAGATTTGAACCATTTGATCTCTGCCACCATGAGTGGAGT
GACCTGCTGCCTGAGGTTCCCTGGCCAGCTGAACTCCGACCTCCGGAAGC
TGGCAGTGAACCTGATCCCCTTCCCACGTCTCCACTTCTTCATGGTTGGG
TTCGCGCCCCTGACCTCCCGCGGCTCCCAGATGTACCGCTCCCTCACCGT
CCCGGAGCTCACCCAGCAAATGTGGGACTCCAAGAACATGATGTGCGCCG
CGGACCCCCGCCACGGCCGCTACCTCACTGCCTCGGCCATGTTCCGTGGC
AAGATGAGCACCAAGGAGGTGGACGAGCAGATGATCAACGTGCAGAACAA
GAACTCATCCTACTTCGTGGAGTGGATCCCCAACAACGTCAAGTCGAGCG
TGTGCGACATCGCGCCGAGGGGCCTGTCCATGGCGTCCACCTTCATCGGC
AACTCCACGTCCATCCAGGAGATGTTCCGGCGTGTGAGCGAGCAGTTCAC
GGCCATGTTCCGGCGCAAGGCCTTCCTTCACTGGTACACGGGCGAGGGCA
TGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTCGTC
GCCGAGTACCAGCAGTACCAGGACGCCACCGCCGACGAGGAGGAGGAACT
GTACGAGGACGAGGACGACGCCGACCTTCAGGAGTAGGGAGGGGCGAGGT
CTGTTCTTGGTCGTCGTGCTCAGGGTCAGGGGGCTATTTCTGATGGCTCC
CTGTCGCTGCTAGTAGTTTGTATGTTGCGGTTTGGGTGTGACGGGGCTGC
CCCCATCTTCGGGGAGTCGTGGACTTGTTGCTTGTGTAGTTTGCATTTGT
CAGAGTTAATTTGGTAGTCAGTTTGTTGGCGGTGAACTTGAATATCTAGC
AGGTTTGTAATATGGCTCGTTCTGAATCCCAAGGAATGTTTGCTGTTTG
BLAST
BLAST Search