Query (optional)   in Class  

GrainGenes Sequence Report: AK366640

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AK366640
Locus
AK366640
DNA
GATCCATTCAACAAATTAAGCGCAAGCAGCTAAAGCAGTATCAGTCTTAA
CACACAGACACGGAGACACACAGACACAGAGACACACACACACACACACA
GATCAGTCCAGCTAGTTGGAGATGGCCGGAGGAGATGACCTGAAGCTGCT
CGGCGCATGGCCAAGCCCGTTCGTTACCAGAGTGAAGCTCGCGCTCGCCT
TGAAGGGCCTGAGCTACGAGGACGTGGAGGAGAACCTGTCCAACAAGAGC
GAGCTCCTCCTCAAGTCCAACCCGGTGCACAAGAAGATACCCGTGCTCAT
CCACAACGGCTCCCCGGTATGCGAGTCCATGATCATCGTGCAGTACATCG
ACGACGTCTTCGCCAGCACCGGCCCGTCCCTTCTCTCCGAGGACCCCTAC
GAACGCGCCGTGGCTCGCTTCTGGGTGGCCTACGTTGACGACAAGCTGGT
AGCCCCATGGAGGCAGTCGTTGAGGGGCAAGACAGAGGAGGAGAAATCCG
AGGGAAAGAAGCAGACGTTCGCCGCGGTGGAGGTCCTCGAAGGGGCCCTC
AGGGAGTGCTCCAAGGGAGGGGACTTCTTCGGCGGGGACGGCGTCGGGCT
CGTCGACGTTGCGCTGGGAGGTCTGCTCTCGTGGATGAAGGTGACCGATG
TGCTTTCCGGTGACAAGATCTTCGACGCCGTCAAGACTCCGCTCCTGGCC
GCGTGGGTGGAGCGCTTCAGCGCGATCGACGCGGCAAAGGCGGCCTTGCC
GGATGTGGGCAGACTGGTTGAGTTCGCCAAGGCACGAGAGGCTGCCGCTG
CAGCGTCTAAGTGAGCCAGCAGATATCCAGAATAATTAAAATTTGTTATT
TTTAAATGTTGTTTGTTTGGCTGCTGGATGTAATAATAATGTTAGAGTAA
CGTTTTACTG
BLAST
BLAST Search