Query (optional)   in Class  

GrainGenes Sequence Report: AK367613

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AK367613
Locus
AK367613
DNA
GATGGCATTGTGTGAGAAATAAACCAACGAAAATTGTCCCAACTCTCCTA
GTGTCATCTACAACTATCAATGCTCAGGCTGAAAGTGAGCTGGATCATCC
AGGGTTGGCAAAACTCATTGCAGCACATGCACGTCCTCCAAATTACTTGA
TGTTCTTTGAATTCTTTGAGCCTCCAAACTTAGCAGATAAGATACATGTT
GAGGAGTGGAGCCCTTCTATCCAGCAAGTGGTCATGATTGCCAGCTATCT
AGCAAAGACTCTCCAATACCTACAAATCTTCGGGATAGTACACAGAGATA
TAAAACCAGCAAATATTTTGATTTTGGCTTGGCTATGTACCAGAAGGATA
TTAAAAGTGTTTCAGCTGTGAACTGGAAATCATCTGGCAAGCCTACCGGT
GGTTTCTATAAAAAGAATATGGTTGGGACACTAATTTACATGGCACCAGA
AATTTTGAGAAAGGGTCTACATACAGAAAAATCCGATGTTTATAGCTTTG
CAATATCAATAAACGAGCTTCTTACTGGTGTTGTGCCTTACACAGATCTG
CGAGCTGAAGCACAGGCACACACCGTTCTTGAAATGACTTACACTGAACA
GCAACTTACATCAGCTGTTGTTTCTCAAGGGTTGCGCCCTGCTCTAGCCC
TTCTAGAGTCTGGCTCTCCACCAAGTCTCTTGTCACTTATTCAGCGCAGC
TGGGATTCTGATCCTGAACGGAGACCATCATTTGGAGATATAATTGAAGA
GTTAAATGTAATACAGAAGCATTTAGTTACATATTCTTGCCCTCTATCAT
CTGGTTCAATGGACATGAGTCAAAACAGCAAGGCAGAAGCACACCATTAT
CAAGAAGCATTAAACTGGTTTAAACAAGGGGAACTGTTAACAAAGAAAGC
AAACAAATTAGACTACGCAGTGAATCCTTGGTCTGGTTCATTTGATCAGT
CCTCTCTCTCCGTGTATCATCCAACTTTGAGCTGGGGATCTTTTGCAACA
TGTGGACGAAGAGAAACAATGGAAGATACTCATTTTATGCTTCCCTGCAT
GTCTGAAGAAAAAGACGTGCATTCCTTTGGCATTTTTGATGGACACAGAG
GTTCAGTGTTTTTAAGTCTACGTTTTGATTTTTACTAGGTTTGCATTAGC
ATACATTACACAATATTCTTACAGGTGCGGCAGCTGCTGAGTTTTCTGTC
CGAGCAGTTCCTGGATTTCTCAAGCAATTTGGACACACTGCCAGCCCAAT
TGATGCCCTTTCAGAAGCATTTGTAAGGAGTGACACAGCATTTAGAGAAG
AGTTAATTGTTCACCAAAAGTCAAAAAGGATAATCCAGAAGGACTGGCAT
CCTGGTTGCACGGCAGTGACAGCATTGATAGTGAGAAACAAACTTTTTGT
AGCAAATGCTGGTGACTGCCGAGCAATTCTTAGCCGTGCTGGCAAACCAT
TTCCCATGACTAGGGATCATATTGCTAGTTGCCCCAAGGAAAGAGAGCGT
GTTGTAAAAGAAGGGGCTGAAGTCACATGGCAAATAGATACATGGCGAGT
CGGTGCAGCTGCTCTTCAGGTTACAAGGTCAATTGGCGATGACGATCTCA
AGCCAGCAGTGACAGCATTGCCTGAGATAATTGAAACTGATTTATCAGCT
GATGACGAGTTCCTGGTCATGGCTAGTGACGGACTCTGGGATGTGGTAGG
CAACAAGGACGTTCTTTCCATCATCAAGGACACAGTGAAAGAGCCTGGAA
TGTGCTCCAAGAGGCTGGCTACTGAGGCCGCAGCGCGGGGCAGCAAAGAT
AACATCACTGTTATCGTTGTCTTCCTTCACTCCGTCTCCACAGCAGAAAG
AATATACTAGCCACCACCATTCTACCAAGTGCTCCCTCTGTACCTAAATA
ATTGTAATTGGAAAAAACTAGTACAGATGGAGTACATTCTATGACCCATA
CGCACATTCATATACGGGTACAAATTAATCATGCTGTACTGGACCAGAAG
GAACAAATGATGTTAAGACCGTGGAATTTATTTCTTCCAAGTATTTTGCA
GTTCCATTGTAATAATATTTGTATACCGTGCATACAAGCTAGGGCCTGTT
TGGAATACATGATATACAAAACACAGGAATTATCAGCC
BLAST
BLAST Search