Query (optional)   in Class  

GrainGenes Sequence Report: AK372355

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AK372355
Locus
AK372355
DNA
GACCAGCCACGCAAGAAACTGGCCATGTCTCCCCTCCACCGCCACATCAC
CGCCCTCCTCGTCGTCCTCTTCGCTGCCGCTTCCCATGGCGATCCGACGT
GCCAGCTCGAGCCTTCCGTCTGCGGCGATCTCACCGTCCGGTACCCGTTC
CATCTTTACAACGGGACAGACGAGGCGCTCACGGGGTACGGCGAGCCGCC
GCAGTCGTCGTACTGCGGCTACCCCGGCCTGGCCATCGTCTGCGACGACG
ACAAGCCCTTCCTCCGCCTCGGCGCCGACGACTACACCTACACGGTGTCA
GACATCAACTACACCAGCCTCACCGTGTCCCTCGCCGACGCCGACGTCGG
CGTCGGCGACGGCACCTGCCCTACGGTGCGTCACAACGTGACCGTCCGGG
ACCCCTTCCATCTGCCCACCTCCACCGTCGCCTACCTCTTCTTCTTCCTC
AACTGCACCTTCGACCCGGACGCCGTTCTCGGCCCCAAGCCATCGCGCAA
GCCGCCGAGCATCAAGCCGGTCACCTGCGGAGGCACCGAAGGAGAGGCCA
TTGCCATGTCCTTCGTGCTCCCGGAGCGCGAGATCCCTCCCAAGGACTGG
TGGCAGGCGTGCCGGTCAGTCTACGCGGCCCCGGTGCTCAAGGACGCGCT
CCCGGCCGACGCCAAGGACCCCGGATGGAGGGAGGACGGGTACGCCAAGG
CTCTCCGCGGCGGGTTCCAGGCGGGCTGGGACCGGAGCTCCGGCCCGTGC
GCCCAGTGCGAGCAATCCGGCGGCAAGTGCGGCTACAACCGCACCGGCGG
CCTCCTGGGCTGCTTCTGCGCCAATGGCGCCCTGGCGGGCACCGCCGCCG
GCTGCAGCAAGATATCCGACACCACCGCGCCGCTGCCCGGATTGAAGAAG
AAAAATACAACATGGGTTATAGTAGGTGCAGTGGTCGGTGCTACCGCTGT
CTTGCTTGCTCTTGCCGCGATAGCCTTTTTGTTCATTCGCAAGAGAAGGC
AGAGGAAGGTGGTGAACTCGTCTTCGAAGCTCCTCAAGTACCGGTACAGC
GGCTCCGGCGGGACCCCGACGCGCTCCAGGGGCGGCGACATGGAGTCCGG
CAGCTCCCAGGACATGGGCAACCGGTTCAGCTACGAAGAGCCCGAGGAGG
CCACCGATTCCTTCAACGAGAAAAGAGAGCTCGGCGACGGCGGCTTCGGC
ACCGTCTACAAAGGGTACCTTGGGGACGGTCGGGTGGTGGCGGTGAAGCG
GCTGTACAACAACAGCTACCGGCGCGTGGAGCAGTTCGTGAACGAGGCGG
CCATCCTGGCCCGGCTGCGACACCCGAACCTGGTCATGTTCTACGGCTGC
ACCTCCAAGGAGAGCCGCGAGCTGCTCCTGGTCTACGAGTTCGTCCAGAA
CGGGACGGTCGCCGACCACCTCCACGGGCCCCGCGCGGCGGAGCGCGCCC
TGCCGTGGCCGCTCCGACTGAATGTCGCCGTCGAGTCCGCGGCGGCGCTC
ACCTACCTCCACGCCATCGAGCCGCCCATCGTGCACCGCGACGTCAAGAC
CAACAACATCCTCCTCGACACCGACTTCCACGTCAAGGTCGCCGACTTCG
GCCTCTCCCGGCTCTTCCCGCTCGACGCCACCCACGTCTCCACCGCCCCC
CAGGGCACCCCAGGGTACGTGGACCCGGAGTACCACCAGTGCTACCAGCT
GACGGACAAGAGCGACGTGTACAGCTTCGGCGTGGTGCTGGTGGAGCTCA
TCTCGTCCAAGCCCGCCGTGGACATCACCCGGCAGAGGAACGAGATCAAC
CTGGCCGGCATGGCCATCAGCAAGATCCAGAAGTGCCAGATCGAGGAGCT
GGTGGACCTGGAGCTCGGCTTCGAGTCGGACCCGGCGACGAGGAAGATGA
TGACCATGGTGGCGGAGCTGGCCTTCCGGTGCCTGCAGCAGAACGGCGAG
ATGCGACCGCCGATCAGGGAGGTGCTGGACGTGCTCAGGGCCATCCAGGA
TGAATGCCTGGGTCACAAAGACGGAGGAGGCAAAGGCAAGGACTTTGTCG
AGCCCTTCTCTCCAAACACCGTGCACGCTCCCTGGGACAGCAGGACTACC
ACCCCTAACACCAGCCAGTAGTAGATTAGATCAGTGTTTGCGGCCGGTCC
AGTTTTTATTTTATCACTAGTGAGAGCTGCTCGCCGCGTATGAGGCGATC
CGACGATTTTTTTCCCCTTTCCAGGTGATGTAAATATGTGCTTGTTTTTT
TGAACTGCTTAGAGCAGAGGCAGTACTGCACATACATACATTGGAGTGGT
GTGCTGAACTGGTTATATGTATGATACATATGATGATGATTACATAGGTT
TCCTTTTACC
BLAST
BLAST Search