Query (optional)   in Class  

GrainGenes Sequence Report: AL450623

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AL450623
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC175948
NCBI UniGene
Hv.3123
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf34j06, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
Hordeum vulgare Barke etiolated leaves
Tissue
etiolated leaves
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
AL450623 Hordeum vulgare Barke etiolated leaves Hordeum vulgare subsp. vulgare cDNA clone HK03H22u 5', mRNA sequence.
Strain
lab_host XL1Blue
vulgare
Clone
HK03H22u
Probe
AL450623
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Michalek W; Institute for Plant Genetics and Crop Plant Research; Corrensstr.3, D-06466 Gatersleben, Germany; Email: michalek@ipk-gatersleben.de, http:
Note: Vector: pBluescript SK-; Site_1: SalI; Site_2: NotI ; mRNA was made from etiolated leaves of spring barley variety 'Barke', a high quality malting variety. Plants were grown on filterpaper for 6 d at 25 C in the dark. Leaves were harvested at daylight conditions. Sal-Adaptor Sequence: TCGACCCACGCGTCCG Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp.
Note: Vector: pBluescript SK-; Site_1: SalI; Site_2: NotI; mRNA was made from etiolated leaves of spring barley variety 'Barke', a high quality malting variety. Plants were grown on filterpaper for 6 d at 25 C in the dark. Leaves were harvested at daylight conditions. Sal-Adaptor Sequence: TCGACCCACGCGTCCG Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp.
DNA
gagaattaatactgctacgccaactagtagcagctcaagagtcgattgat
tacggtacgtgcgtcgaggtcgatcgatccataggaaggaaggaaggata
ggaaggataggatgcagggtgaggtggagcagcaggcgccgatgcagatg
gtgctgcgggtgaagcacccgtcgtcgctgtccagcggcagcgatgaggc
ggcggaaggggaggggtcgtccaggtcggcgctctccgtgttcaaggcca
aggaggagcagatcgagaggaagaagatggaggtcagggacaaggtgttc
gcgcagctcggacgcgtcgaggaggagtccaagcgcctagcattcataag
acaggagctggaagggatggccgatcctaccaggaaggaggtggaatcaa
tacagcggcggatcgacaccgtcaaccgccagctcaagcccctcagcaag
agctgcgtcaagaaggagaaagaatacaaagaggttctcgaggcgtacaa
cgagaagagcaaggagaanggcatacttgtcaacagg
BLAST
BLAST Search