Query (optional)   in Class  

GrainGenes Sequence Report: AL500721

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AL500721
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC153985
NCBI UniGene
Hv.58
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'PIP aquaporin'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
Hordeum vulgare Barke roots
Tissue
roots
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
AL500721 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare cDNA clone HW01K05u 3', mRNA sequence.
Strain
lab_host XLOLR
vulgare
Clone
HW01K05u
Probe
AL500721
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Michalek W; Institute for Plant Genetics and Crop Plant Research; Corrensstr.3, D-06466 Gatersleben, Germany; Email: michalek@ipk-gatersleben.de, http:
Note: Vector: plasmid pBK-CMV; Site_1: EcoRI; Site_2: XhoI; mRNA was made from roots of spring barley variety 'Barke', a high quality malting variety. Roots were grown for two days on filter paper at room temperature Cloning sites: EcoRI (5'-end of cDNA) and XhoI (3'-end of cDNA). NOTE: Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRI adapter. Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp
DNA
ttttttttttttttttttttttttttttttttttttttttttttttttct
taaacggtaccaattctttgattaccaaattctccacatacatacataca
tacatacatacatagagcgagcaaaagaaaagcacacttggaagaaacag
cagcaagcaaacatggcgaactccggaaacacgtcgacatacgaatggac
ggtcacatcaacatatgcacaagccgaggaacggtagcagcagatgatgc
gaagactggagccactgaaccaagcggngggatcgagcagccatagcgca
ttggctggaggcggccttcttcttcgcacatatctacacttcagtgcccc
ccctcgcgcgtccggccggagctacgggcgacttaggtgctcctgtagga
cccga
BLAST
BLAST Search