Query (optional)   in Class  

GrainGenes Sequence Report: AL510916

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AL510916
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC183465
NCBI UniGene
Hv.21312
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Transcribed locus'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
barke
Clone Library
Hordeum vulgare Barke developing caryopsis (3.-15.DAP)
Tissue
developing caryopsis (3.-15.DAP)
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
AL510916 Hordeum vulgare Barke developing caryopsis (3.-15.DAP) Hordeum vulgare subsp. vulgare cDNA clone HY06G13u 3', mRNA sequence.
Strain
lab_host XLOLR
vulgare
Clone
HY06G13u
Probe
GBM1048
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Michalek W; Institute for Plant Genetics and Crop Plant Research; Corrensstr.3, D-06466 Gatersleben, Germany; Email: michalek@ipk-gatersleben.de, http:
Note: Vector: plasmid pBK-CMV; Site_1: EcoRI; Site_2: XhoI; mRNA was made from developing caryopsis (3.-15.DAP) of spring barley variety 'Barke', a high quality malting variety. Cloning sites: EcoRI (5'-end of cDNA) and XhoI (3'-end of cDNA). NOTE: Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRI adapter. Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp
DNA
tttttttttttttttttgtgtattacagtctttattttttattctttgat
gaggcacattcatgttaggtactataacggaagatgtatgcccggcgtct
gcattcattattggtttcttcgcaagaacggaaacagattcctgaccgtg
cttacacatttcgctttcagactttgatgcgagagactaatcaatcaacc
agactctgtagctttatctgtaaataatagtaagtagatgaacgcgacgt
gcacgaatagcagcctagctaagccagcagcagcagcagctctagttcca
tgcgcgtgtggagcagtctagctaaaccttgcgggccagccggtcgaagc
tgatgggcgcggtgaacccggccgctccgtcgaagaaggcggcggcggtc
agctctccggcccgctgcgagggatggcccc
BLAST
BLAST Search