Query (optional)   in Class  

GrainGenes Sequence Report: AL827092

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AL827092
Contig
Ta.1018.2.S1_x_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC283124
NCBI UniGene
Ta.714
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_523710.1 calmodulin, isoform A [Drosophila melanogaster]'
Keyword
EST
Species
Triticum aestivum
Cultivar
mercia
Clone Library
p:638
Tissue
normal seedlings
Developmental Stage
21 days old
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
AL827092 p:638 Triticum aestivum cDNA clone E02_p638_plate_7, mRNA sequence.
Clone
E02_p638_plate_7
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Barker G; Institute of Arable Crop Research; Long Ashton, Bristol BS41 9AF United Kingdom.
DNA
cgcgccccgtttattattccccttcgcgcagccgcccccgtgtctcccgt
gcgcaccttctcgaagcctcccccatggcggaccagctcaccgacgagca
gatcgccgagttcaatgaggccttcagcctcttcgacaaggatggcgacg
gttgcatcaccaccaaggagcttggaaccgtgatgcggtccctcgggcag
aaccccacggaggcggagctgcaggacatgatcaacgaggttgacgcgga
cggcaacggcaccatcgacttccccgagttcctgaacctgatggcgagga
agatgaaggacacggactcggaggaggagctcaaggaggcgttccgcgtg
ttcgacaaggaccagaacggcttcatctcggcggcggagctgcgccacgt
gatgaccaacctcggggagaagctgacggacgaggaggtggacgagatga
tccgggaggcggac
BLAST
BLAST Search