Query (optional)   in Class  

GrainGenes Sequence Report: AL830217

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AL830217
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC287036
NCBI UniGene
Ta.54141
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_200875.1 60S ribosomal protein L12 (RPL12C) [Arabidopsis thaliana]'
Keyword
EST
Species
Triticum aestivum
Cultivar
florida
Clone Library
q:343
Tissue
ovules
Developmental Stage
pre-fertilization
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
AL830217 q:343 Triticum aestivum cDNA clone A07_q343_plate_2, mRNA sequence.
Clone
A07_q343_plate_2
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Barker G; Institute of Arable Crop Research; Long Ashton, Bristol BS41 9AF United Kingdom; Sequenced as part of the BBSRC Investigating Gene Function program; Wilson I., Beswick R., Shepherd S., Barker G., Parker J., Owen P.,; Edwards D., Coghill J., Holdsworth M., Lenton J., Shewry P.,; Edwards K. A BBSRC-funded wheat EST resource for the academic; community. Unpublished.
DNA
caccggcggggaggtcggcgctgcgtcgtccctagcccccaagatcggtc
cgctcggtctctccccaaagaagatcggagaagacatcaccaaggagacg
gccaaggactggaagggcctccgcgtcaccgtcaagctcaccgtccagaa
tcgccaggccaaggtgtccgtcgtcccctccgccgcagccctcgtcatca
aggcgctcaaggagcccgagagggaccgcaagaaggtcaagaacatcaag
cacaacggcaacatcagcctcgacgacgtcttcgagatcgc
BLAST
BLAST Search