Query (optional)   in Class  

GrainGenes Sequence Report: AV910875

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AV910875
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC154379
NCBI UniGene
Hv.4291
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CM 72 germin subunit'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
Akashinriki
Clone Library
K. Sato unpublished cDNA library, cv. Akashinriki vegetative stage leaves
Tissue
leaves
Developmental Stage
vegetative stage
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
AV910875 K. Sato unpublished cDNA library, cv. Akashinriki vegetative stage leaves Hordeum vulgare subsp. vulgare cDNA clone baak11d04 3', mRNA sequence.
Strain
vulgare
Clone
baak11d04
Probe
baak11d04
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Tadasu Shin-i; Center For Genetic Resource Information; National Institute of Genetics; 1111 Yata, Mishima, Shizuoka 411-8540, Japan; Tel: 81-559-81-6856; Fax: 81-559-81-6855; Email: tshini@genes.nig.ac.jp.
DNA
atttattacaactgcatgcgagattaaccggaagcttgaatacatgtctt
ctgctgagaatcattaaattttgctaccatgcatatacagaattatgcat
tgattatttaaggaaggctcccaggaattaaaacccagcggcgaacttgg
acttgagaagttccacgacccctgcctccacccggagcgccttggtgagc
accggcgtcgggataggcgggtttgagccgaagagcgtgagcggcacaaa
gacgatgccagggttttggctgttgaaggagacgaccatggaggcctccg
tcttaccgacgttgaactggaagtgcatgaggccacgggggatgaggaag
gtctctccagcgcgcaccaccctggagtagagcttgttcccggagtcaag
gctgccgaggattccaacgaggagctcacctttcatcacgatgcctatct
cggtggcacgggggtggacgtgcggcgggttggtgccccccggcgcgaag
ttccacccgattcatggacacgcccagcgtgttcgtaccgggccactcag
ccacgtcgagctccgtcacggccgagccgttgggggtagacgtgttgccg
gccttggccagctttgacgagaaaaggaagtcatcgccggcctccgacat
gggcttgcacggatgaccattcactgagaccgctttgccgtcaaggtcgg
cgaca
BLAST
BLAST Search