Query (optional)   in Class  

GrainGenes Sequence Report: AV910983

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AV910983
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC159390
NCBI UniGene
Hv.13772
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf148d05, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
Akashinriki
Clone Library
K. Sato unpublished cDNA library, cv. Akashinriki vegetative stage leaves
Tissue
leaves
Developmental Stage
vegetative stage
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
AV910983 K. Sato unpublished cDNA library, cv. Akashinriki vegetative stage leaves Hordeum vulgare subsp. vulgare cDNA clone baak11j13 3', mRNA sequence.
Strain
vulgare
Clone
baak11j13
Probe
baak11j13
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Tadasu Shin-i; Center For Genetic Resource Information; National Institute of Genetics; 1111 Yata, Mishima, Shizuoka 411-8540, Japan; Tel: 81-559-81-6856; Fax: 81-559-81-6855; Email: tshini@genes.nig.ac.jp.
DNA
aaatctaatacgacaatttgtgttacactttcttttcatatatcatcaac
aaatgatgtttacaacatgaacaacagaatcaacaccctgtaaaatggaa
taataagtgatcccaaaatctgtatctgaaatgctattacaacacacgac
acgatcggtgaacaatgttcttatttgactgatggcgcggaggcgcagca
cgctctttgacctttgtgcaacgcacatctcttcctccttgcgattggct
gattcttgcaaggtgaaccatcggatgcccgagctccacagacagatggc
aataccgaccttccggaacatggtgccgatgacgcaccagtgacctcaat
tcctctgtgctcctcgcatctttcccttcctgtcaccggttccagtttgc
agtatccattatctgtcactactccacataaggctgatgcgtcgttgttt
gcttctcttggctgacatccttggcctctcgacgatggtgcgttggctga
tttctgtgctttgagcagctcaaaccacttccttccacaaggctcatctt
cgtggaactgagattctgcatgggaggttccatatgcttcatcttctgta
ggagcttct
BLAST
BLAST Search