Query (optional)   in Class  

GrainGenes Sequence Report: AV911420

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AV911420
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC165347
NCBI UniGene
Hv.4827
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf39h01, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
Akashinriki
Clone Library
K. Sato unpublished cDNA library, cv. Akashinriki vegetative stage leaves
Tissue
leaves
Developmental Stage
vegetative stage
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
AV911420 K. Sato unpublished cDNA library, cv. Akashinriki vegetative stage leaves Hordeum vulgare subsp. vulgare cDNA clone baak13c05 3', mRNA sequence.
Strain
vulgare
Clone
baak13c05
Probe
baak13c05
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Tadasu Shin-i; Center For Genetic Resource Information; National Institute of Genetics; 1111 Yata, Mishima, Shizuoka 411-8540, Japan; Tel: 81-559-81-6856; Fax: 81-559-81-6855; Email: tshini@genes.nig.ac.jp.
DNA
taagcaatagtaaattccagtcatgtataatataacccaagatggcatat
aacgccaacggctacgtaatatacagcataaaccaccagaaagtgtcagc
attttattcttcgatgtgtgaagcatggtgaatgcaaatataccatgtgc
catctatcttctcgaagacgttggtggcaatttgcttcccccaagatttt
cctttggtcttaaccaactccaagcatgtaacataaccaaggtcaccacg
cacatgaacctctatgttcttaagctcaatgtttagagggaactcataat
ccgcattgcaaaccatctcccagctttgcaagaccacatcgtaaccggat
atccgacctgcacctggatggacaacatacacatagtctcctttagccca
gatagagttcattgcagtaaaatctccattcttgaaagcgttgtagaatc
gtgtatttgctgcaaggacggaagcttcagtatcctcatggaggacgtgc
agatcatcccggattttggcagcacgggcataatcttcttcccggatagc
cctgtccaaattacgctgaagggtttcttcgtcggctaactcgtcttcag
tttttggatagccatcagcatccccacttttaacatggcaaattctggat
ctgttgaagttggaggctgcaatttgaacccctgcaa
BLAST
BLAST Search