Query (optional)   in Class  

GrainGenes Sequence Report: AX-94631087

[Submit comment/correction]

Sequence
AX-94631087
Locus
AX-94631087
Species
Triticum aestivum
Other Name
BA00401747  [ wEST-mySQL (obsolete) ]
Probe
AX-94631087
BA00401747
Reference
ReferenceAllen AM et al. (2017) Characterization of a Wheat Breeders' Array suitable for high-throughput SNP genotyping of global accessions of hexaploid bread wheat (Triticum aestivum) Plant Biotechnology Journal 15:390-401.
Type
SNP
DNA
TTGTTCATCTGGTGTCTTAATTTGTAGTACTTCATRGTATGCTTGTACTT
GCTAGCAATGCATCTTGGAAA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.