Query (optional)   in Class  

GrainGenes Sequence Report: AY174159

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AY174159
Subsequence
AY174159_1.cds41878
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Aegilops tauschii
Species
Aegilops tauschii
Data Source
genbankRelease 135, Apr 15 2003
genbankDownloaded 2008-2009
Title
Aegilops tauschii high molecular weight glutenin subunit (1Dy13t) gene, complete cds.
Gene
1Dy13t
Gene Product
high molecular weight glutenin subunit
Remark
DB_xref: taxon:37682
Feature: source: mol_type = 'genomic DNA';
Gene: 1Dy13t
EMBL Feature
feature_gene41878Location: <4..>1878
DNA
rgnatggctaagcggctggtcctctttgcggcagtagtcatcgccctcgt
ggctctcaccaccgctggaggtgaggcctctaggcaactacagtgtgagc
gcgagctccaggagagctcgcttgaggcatgccggcaggtcgtggaccaa
cagttggccggtcggctgccatggagcacggggctccagatgcgatgctg
ccagcagctccgaggtgttagcgccaagtgccgctccgtcgccgccagcc
aagtcgcaagacaatatgagcaaactgtggtgccgcccaagggcggatcc
ttctaccctggtgagaccacaccactgcagcaactccaacaaggaatatt
ttggggaacatcttcacaaacagtacaagggtattacccaagcgtaactt
ctcctcggcaggggtcatattatccaggccaagcttctccacaacagcca
ggacaagggcaacagcctggcaaacggcaagaaccaggacaagggcaaca
atggtactacccaacttctctgcagcagccaggacaagggcaacagatag
gaaaagggcaacaagggtactacccaacttctctgcagcagccaggacaa
gggcaacaaataggacaagggaaacaagggtactacccaacttctccgca
gcacacaggacaaaggcaacaaccagtacaagggcaacaaccagaacaag
ggcaacaaccaggacaatggcaacaagggtactatccaacttctccacag
cagctaggacaagggcaacaaccaggacaatggcaacaatcaggacaagg
gcaacaagggcactacccaacttctcagcaacagccaggacaagggcaac
aagggcactacccagcttctcagcagcagccaggacaagggcaacaaggg
cactacccagcttctcagcagcagccaggacaagggcaacaagggcacta
cccagcttctcagcagcagccaggacaagggcaacaagggcactacccag
cttctctacagcaaccaggacaagggcaacaagggcattacccaacttct
ctacagcagctaggacaagggcaacaaacaggacaaccaggacaaaagca
acaactaggacaagggcaacaaacaggacatgggcaacagccagaacaag
agcaacaacaaggacaagggcaacaaggatactatccaacttctctgcag
cagccaggacaagggcaacagcaaggacaagggcaacaagggtactaccc
aacttctctccagcagccaggacaagggcaacaagggcactacccagctt
ctctgcagcagccaggacaaggacagccaggacaaaggcaacaaccagga
caagggcaacatccagaacaagggcaacaaccaggacaagggcaacaagg
gtactatccaacttctccacagcagccaggacaagggcaacaactaggac
aagggcaacaagggtactacccaacttctccgcagcagccaggacaaggg
caacaaccaggacaagggcaacaagggcactgcccaacgtctctgcagca
gacaggacaagcacaacaatcaggacaaggccaacaaataggacaagtgc
aacaaccaggacaagggcaacaagggtactacccaacttctctgcagcag
cttggacaagggcaacagtcaggacaagggcaacaatcaggacaaggaca
ccaaccaggacaagggcaacaatcaggacaagagcaacaaggctacgacg
gcccataccatgttagcgcggagcagcaagcggctagcccaatggtggca
aaggcgcagcagcccgcgacacagctgccgacagtgtgtcggatggaggg
gggcgacgcattgtcggctagccagtgatag
BLAST
BLAST Search