Query (optional)   in Class  

GrainGenes Sequence Report: AY277385

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AY277385
Subsequence
AY277385_1.cds9453163
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q84LJ5
DB Remark
Locus Source: Avena sativa (oat)
Species
Avena sativa
Data Source
genbankRelease 145, Dec 15 2004
genbankRelease 141, Apr 15 2004
genbankDownloaded 2008-2009
Title
Avena sativa 1,3-beta glucanase (Oglc13) gene, complete cds.
Gene
Oglc13
Gene Product
1,3-beta glucanase
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'genomic DNA';
Feature: source: mol_type = 'genomic DNA'
Gene: Oglc13
EMBL Feature
TATA_signal853858Location: 853..858
polyA_signal32043209Location: 3204..3209
feature_gene8533281Location: 853..3281
DNA
tttccaagacataaatngcaagccgaaatctttctttttggccatggaga
taataaatttttactgcctgggaaatatggatatgcaaaaataatttttt
ttttgaaaatgttacaccagagttctctaattgaaaagctgtttttgtgc
aagaaatgaggtggatcaaattcagaataaaaaataagcatggctttcag
ctcaaggagccgccacctccngctgcttgatccgccccatgccccatgcc
cgttcgccattgtgccgtctccacgctggtgtagaagacgaagaaggcgt
cgccgcccccgcctcagatcgatgctgaagcgattcagctgccgtcacgc
cacccgggctttttaggcaaaaccttaagcggcggcgagaggaggagggc
ttgtgatggccttgctggcggggtggcggagggtgctccgactcccctcc
gtcaccaatataagatgttttagcaaactaaaaatattttgcttttctag
agaaaaacaagctactcctacttactacagtactagaaatagcgcgtata
catggccatgcgtgcagctcaactgctcaagtactcgaggaaaactgaga
ccggccggttttccacaatatgtggactttgtttcgagtggccgcacttt
cagttgtttccgtggaagaaagacggaatgcgacgacgatcgagttaggt
gggccgcaccgaagagtgacgtccatgaccacgactccatgagcatgcac
gtatgtgcgccagccagcctgccatggcgtgcatctccagttatacgtgt
cgtctctgttacgagtcaaaaaaggtaagttgaccacacgccagggcttg
tgtatataaggggtgcctagcgcagctggatcggcacaccaagcggggca
ccgaggagcacatactccacatatttggatcgaggtagcaggcgatgtcg
aggcaggatgttgcttccatgtttgtggttgccctcgtcgttggagcttt
tgcttctctccctacatgtacgcatacctctgcatgtttttatttttttg
atctgcttttcatgcaagttcatactcgtatgataaggcctttcatatat
tgagtaaactccattatgacatgggtctctttttttctcttgcactgcta
acttggaaaagattcccctaaaaaaaacttggaaaagatttgaaaatcat
cgcgtgggtccctcttttttcgttttcactagagttttctatatgcataa
tttctcgatgttttcatgtataaatcataagaagtggagaattgagcgct
aaatgggcacataagtaataaataaagtgctaaacggggtggccaatttt
ttcagaccacttatgtgtatagaggtgaaattctttttcttcctttttat
caaagaacccgataatttggcttcttggtattttattgattgaaccctgg
ttcactacacaaattcataattgctttcttcccctcttcttaattcatga
atttgtgataaataaagatctagcttgggtataatgtggcaaaattttct
aaaacgaggtgcttttatcggaaacacttaaaggatacaaagtagatttt
tctgtagttttgtaatgaagaatttatcaacttattttattgttattttg
atcatacaatttgtaatgcattgcacaagatttggtactccctctccgat
ccaaattaatggtctcgaatttgcctagattcggatgtatcaagcattaa
agcatgactacattttctgtatctagacaaatagaagaccattaatttgg
atcagagaaggagtaagtgaatttgaagaatagttaagagtgagttttgc
aacaagtccatccgtggtgtgggattcttttcttcggagcctagtggtta
taaatttgtacggcgtgggtgtttgtccgtttctghcggacttgtacatg
actcttctctttttatcaatgcatcaaaacacaaggcttttatgtttttg
cgaaaaaataaatgacggagtagcatcggctctagtaggaataaataaag
gacgtagagaaaagatagagggatagacgttgctccagaattttagtact
gagcccaaatccaaatcgttgcaatcggtggcggacaagcatcgtcggtg
cctagggacaaatccaagtcattcacaagtcacaacatcgtaggacagcc
aataacgaatactgacactccattccatatgcagacgtgcagtcgatcgg
tgtttgctacggcgtgactggcaacaacctcccgtcccgtagcgacgtgg
ttcagctgtaccgctccaagggcatcaccgacatgcgcatctacttcgcc
gacgggcaggcgctgtctgccctgcgcaactcgggcatcggcctcgtcat
ggacatcggcaacgaccagctcggcaagatcgccggcagcgcttccaacg
ccgccgcatgggtccgggacaacgtgcagcgttaccagggcctgaagatc
aagtacattgtggcggggaacgagatccagggcggcgacacggggcgcat
cgtcccggccatccggaacctgaacgcggcgctgtccgcggcgggcctcg
gcggcatcaaggtgtcgacggcgatccggttcgacgcggtggcgagctcc
ttcccgccctccgcgggcgtgttcgcgcagtcctacatgacggacgtggc
gcggctgctggcgagcacgggcgcgccgctgctggccaacatctacccct
acttctcgtaccgcgacaacccgcgggacatccagctcaactacgcgacg
ttccggccgggcaccacggtgcgggacagcaagagcgggctgacgtacac
gaacctgttcgacgcgatggtggacgcggtgcacgcggcgctggagaagg
cgggggcgccgggcgtgaaggtggtggtgtcggagagcgggtggcccaag
acgggcgggaccggcgcgagcacggacaacgcgagggcgtacaaccaggg
gctgatcgaccacgtcggcgggggcacccccaagaagcgcggcgcgctgg
agacgtacgtgttcgcgatgttcgacgagaaccaaaagacaggggctggg
acggagaagcacttcgggctgttcaacccggacaagtcgccggcgtaccc
catccgcttctgatatcatcgatcatcgatcgactaggtgtatattgtcg
tccaaataagctgcacgtaatgcggcagtattgaagtgtggccggatacc
tacatcgtcagaataaagacaaagtcactaa
BLAST
BLAST Search