Query (optional)   in Class  

GrainGenes Sequence Report: As01_aco245_R

[ Printable Version ]  [ Submit comment/correction ]

Sequence
As01_aco245_R
Length
742
Species
Avena sativa
Data Source
Wight, Charlene2018.03
Probe
ACO245
DNA
CTTCAGAATGGCATGGTTCCAAATGGAGAGGSTTCAAATTCAAAGAGCAG
AGCtTAcATCAATTCATGATGTGTTGAAGGGTTTGGTTGATTGGCTCTGT
TCTCaGStGAGGaGCCCTACCCACCCGAACTGTTCTATTCCTACTGcTAC
ACATTGTCTTGCCACTTTGCTAAAGGAGACATATGTTAGAACTTTATTTG
TTCAGGCAGATGGTGTAAAACTGCTCATTCCTTTAATATCTCCAGCTTCA
ACACA
BLAST
BLAST Search