Query (optional)   in Class  

GrainGenes Sequence Report: BCD0263-3

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD0263-3
Data Source
Kuenzel, Gottfried98.05.05
Probe
BCD263
DNA Homology
C72002616rice_EST
[ Show all 84 ]
DNA
aatcctgatgggtgatgcatggactaagccatactccagggagtatgctg
cattccccgcggcgtggcttcgtggtgccaagttctggccaacaacatgt
cgtgtggacaacgtgtacggggatcgcaacctgatctgcactctgcagca
ggaggtggcggaggaagctgcagctgcgaccgkgtaatcttttgatgatg
acgatcctggtgtgtgaactgtgatactgtgtcaagaagttatgatgctt
cctgtaggagggaagcatgcttgcttctaaatccctcatgtactgtatat
attctcctcagatgccaccttctcctgtatcctctgtacccccacgctgc
ctccccattcccatttgaaagtgaaattagctatattggctagcatctcg
tgcc
BLAST
BLAST Search