Query (optional)   in Class  

GrainGenes Sequence Report: BCD0263-5

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD0263-5
Data Source
Kuenzel, Gottfried98.05.05
Probe
BCD263
DNA Homology
T76355642noncereal_EST
[ Show all 46 ]
DNA
ggcacgagagagcacgagctcctccgttacctgcacaagttgcaatccaa
ggatctctcactgtgccacagtatgatccctcttggttcttgcaccatga
aactaaatgctaccgtcgagatgatgcccgtcaccgatcccaagttcgcc
aacatgcacccatttgcccctattgatcaagctgcaggctatcatgaaat
gtttgacaacctgggtgatctgctgaacaccatcactggttttgattcgt
tttctttgcaaccgaatgctggtgcttcaggagagtattctggactgatg
gttattcgggcataccacaaggcaagaggagaccaccaccgaaatgtctg
catcattcccgt
BLAST
BLAST Search