Query (optional)   in Class  

GrainGenes Sequence Report: BCD114_WHE2F0102

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD114_WHE2F0102
DNA Homology
HVU43493688barley_BlastN
[ Show all 43 ]
DNA
cgagtttttttttttttttttttttagatatcactggaattcttatcatg
tatatttctctttatgcatagccgtagtttacatgcacctcacccaaacg
tagttgtagtactcttatgattgtagtactcatacaatgttaactcgagt
tgcagggagagaacacatacacaagcagaacaaaagtaaaaagggaaata
aaatgaacctggcacgaaaccatgttgtatgataaaagggagttagcttg
tttaggccttgccagactcctcgcagcctggtggcttgaaggcgatgang
ctgacgcactgcacctgacgcatgttgtcgnanncccatgtgcggncata
ggcgtcaggggacaccntcttnacctcctccacttcggttaacancngtg
tggcgtcggggcaccccaacataggnagcttnccncattgtccagnatcg
ggcancgtaanancccggngaggcntntgccccccggagatgaatcccan
cctgntggaaatccgngacaanggncccnctggagcggntcaagnantcg
nnctgcntcangagggcctccntngataaccgnnggcaagnaaanaaagn
tcgnacttcttgnngcctcnancgggcagacttgntnnccggttcttncg
ccgtnnnangtgcngaggcanncccgttncgggangggnt
BLAST
BLAST Search