Query (optional)   in Class  

GrainGenes Sequence Report: BCD1355_WHE05H12.s1

[ Submit comment/correction ]

Sequence
BCD1355_WHE05H12.s1
Probe
BCD1355
DNA Homology
S68729212barley_BlastN
[ Show all 96 ]
DNA
cggctaccccggcagcgtcttcaaccccctcaacttcgcccccaccctcg
agaacaaggagaaggagctcgccaacgggagactggccatgctggcgttc
ctggggttcctggtgcagcacaacgtgaccgggaaggggccgttcgagaa
cctgcagcagcacctggccgacccatggcacaacaccatcatccagacca
tctccggccaataaatccgtcgatttcaccgaccaaggaggttttcaggt
ggtctgaanttattattttgggggtgctgaggatgtacaaagtgtgggag
gaagtaaggtggcagtgcaaaaacgtgttgtnaatctttaaagtttccgg
tggtgaaactttgtccttgtgggattcgcccatggcttccgacggaggct
gtacttgtaatatcacccatgcgtgttattttaaaacatggcaaaacata
ctactagtt
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.