Query (optional)   in Class  

GrainGenes Sequence Report: BCD1355_WHE1H0082

[ Submit comment/correction ]

Sequence
BCD1355_WHE1H0082
Probe
BCD1355
DNA Homology
S68729212barley_BlastN
[ Show all 586 ]
DNA
cggctaccccggcagcgtcttcaaccccctcaacttcgcccccaccctcg
agaacaaggagaaggagctcgccaacgggagactggccatgctggcgttn
ctggggttcctggtgcagcacaacgtgaccgggaaggggccgttcgagaa
cctgcagcagcacctggccgacccatggcacaacaccatcatccagacca
tctccggccaataaatccgtcgatttcaccgaccaaggaggtttcaggtg
gtctgaattattattttggggtgctgaggatgtacaaagtgtggaggagt
aggtggcatgcaaaaacgtgttgtaatcttaaagttccggtggtgaaact
ttgtccttgtggattcgcccatggcttccgacggagctgtacttgtaata
tcacccatgcgtggttattttaaaaacatggcaaaacatactactagttg
gaagccaaaaaaaactcgtgncgaattcctgcaaccccggggatccacta
gttctanagcggccgcaacgcggtggagtnccagcttttgttcccttagt
ganggtaattccagntttggggaancatgggcaaaanntttnccggggga
aattgttnncggtccaaattcccacaaatnggnccggaacctaaatnnaa
acntggggnncnatatng
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.