Query (optional)   in Class  

GrainGenes Sequence Report: BCD141_WHE03G11.r1

[Submit comment/correction]

Sequence
BCD141_WHE03G11.r1
Probe
BCD141
DNA Homology
RICS12330A733rice_EST
RICS13256A730rice_EST
C73602171rice_EST
C73602624rice_EST
DNA
aagccacgatgcctattcctatggaactaaaagctttagtaaacctcagg
ctagtacatcttcatcggcgtatcctccctatgaaggtgcacatagggcg
gcccctgctgcaccgtcttctgcttatgataatcaggtgtgccctatctg
ccttgtgaacccgaaaganatggcttttggctgtggacaccagacctgct
gtgaatgtggacagactttggaatcatgcccaatttgccggagcccaatc
ancaccaggataaaactatantagcaagtgggtggnttnggatatcgcga
cttgggttnaatttactggannacnaatcctttnggcaannaacnngacg
attggattgaagagnntttnngagctngggtccatgaaggggnntngatc
ggttctcgggggcttganttctgcatggccggnnnnatgaactngncgcg
ccgaagattngagcangggaacgcctngnngtaatntnncacnctnggca
aggantgantccaaantccat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.