Query (optional)   in Class  

GrainGenes Sequence Report: BCD147_WHE1C0042

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD147_WHE1C0042
Probe
BCD147
DNA Homology
HVU43493212barley_BlastN
[ Show all 601 ]
DNA
cgagtttttttttttttttttttttagatatcactggaatcttatcatgt
atatttctctttatgcatagccgtagtttacatgcacctcacccaaacgt
agttgtagtactcttatgattgtagtactcatacaatgttaactcgagtt
gcagggagagaacacatacacaagcagaacaaaagtaaaaagggaaataa
aatgaacctggcacgaaaccatgttgtatgataaaagggagttagcttgt
ttaggccttgccagactcctcgcagcctggtggcttgaagggcgatgaag
ctgacgcactgcacctgacgcatgttgtcgaatccgatgatgcggacata
ggcgtcagggtactccttcttgacctcctccacttcgttaacacctgtgt
ggcgtcggtgcacccaaacccataggtagcttccacattgtccagtatcg
gccatcgtaataccctggagaggcatgtgcncccgggagatgnatccaac
cttgnctgaactngaganaaggcacccanttgggagcggatcagnaatnc
gaccngnttcaggagtgccnccgtggaaaaccgngggcaataagacnaag
tctcgaaantcttggangcntcatcggccagactgtatgcacggatctnc
cgccgtgctgaggtgcgnngccaccggtttccggtangggnnattgggga
ccaantnggttt
BLAST
BLAST Search