Query (optional)   in Class  

GrainGenes Sequence Report: BCD1502_WHE05A11.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD1502_WHE05A11.s1
Probe
BCD1502
DNA Homology
OSHSP82A1272rice_BlastN
[ Show all 607 ]
DNA
ggagaactctcccttccttgagaagctgaagaagaagggctatgaggtca
tctacatggttgacgccattgatgagtatgccattggtcagctcaaggag
tttgagggcaagaagcttgtctctgccaccaaggagggtctgaagcttga
tgagagcgaggacgagaagaagaagcaggaggaactcaaggagaagttcg
aggggctgtgcaaggtcatcaaggaggtgctgggcgacaaggtggagaag
gtcatcgtctctgaccgtgttgtggactcaccgtgctgtctggtgactgg
tgagtatgggtggaccgccaaccatgggagaggatcatgaaagggcccag
gccttggagggactcgagcatggctggctacatgtctagcaagaagacca
tgggagatcaaccctgagaacgccatctggacgagctccgcaagcgtgcc
gacgccgacaaaga
BLAST
BLAST Search