Query (optional)   in Class  

GrainGenes Sequence Report: BCD1514_WHE04C02.s1

[ Submit comment/correction ]

Sequence
BCD1514_WHE04C02.s1
Probe
BCD1514
DNA Homology
ATAAI220noncereal_BlastN
[ Show all 23 ]
DNA
gaactaacttttattattcgagaagaaacggagacgactcactcgatcca
accccaacagggggctctctctacctgacacagcagctcacaggttcaaa
cagctagtcgcacgcatacattacagtccatgaattgtccacccatcaaa
aaacaactcttcagacccgaatctaggcagactgccggagctccggacgc
acgaatcagcatcggccgtcaccgagatgtcgacggtgggcctcagctcg
gcgcagacctcgatggcgccgtgggacggggtccgacatgaagttgctga
tgaggtcctggttggatgggcgcatccttggtccaccgtcacaaacgcct
gctgggtcangntgtagtcggaagcggggcgcccaatttcctcganccca
gccgggncgtcgtcgancagttgtccaccatggaaggccacc
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.