Query (optional)   in Class  

GrainGenes Sequence Report: BCD157_WHE1C0061

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD157_WHE1C0061
Probe
BCD157
DNA Homology
S68729212barley_BlastN
[ Show all 93 ]
DNA
cggctaccccggcagcgtcttcaaccccctcaacttcgcccccaccctcg
agaacaaggagaaggagctcgccaacgggagactggccatgctggcgttc
ctggggttcctggtgcagcacaacgtgaccgggaaggggccgttcgagaa
cctgcagcagcacctggccgacccatggcacaacaccatcatccagacca
tctccggccaataaatccgtcgatttcaccggaccaaggaggtttcaggt
ggtctgaattattattttggggtgctgaggatgtacaaagtgtggaggag
taggtggcagtgccaaaaacgtgttgttaatctttaaaanttccggtggt
gaaactttgtccttggtgggantngccccatggnttcccggacggaaggg
cttgttactttgnttaaataatct
BLAST
BLAST Search