Query (optional)   in Class  

GrainGenes Sequence Report: BCD1707_WHE05G11.s1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD1707_WHE05G11.s1
Probe
BCD1707
DNA Homology
RNRPS9122noncereal_BlastN
[ Show all 259 ]
DNA
actgcttcatgattaaatagctccagaacatagcaaagtgcaagctaaca
acagagatacaagagaaaaaacgtcctgcctagaggaataaaccatgaca
agcctctcagctaaggtactcatgacaccaacattcccatgatgattgta
ttttgataaattattaggtgatagctactagtagttccttatcactcctc
atcgtcgtcaccaccggcgtcgccagcaccacttgccttctttaggttct
tcctcttcaaccctgccaggggggccctccgccaaatgggcttgttcagc
gaaaaagtcaatgtggcttctcagattcnaaccctcaccatgnaatgatg
ggacgttggacaatttgcctgccaaccctgatgtgggcgctgcctgatca
agacacgggcatggtggattgactttggccatgccagccttgaagacgag
agtctgaaggcgc
BLAST
BLAST Search