Query (optional)   in Class  

GrainGenes Sequence Report: BCD1716_WHE2B0022

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BCD1716_WHE2B0022
Probe
BCD1716
DNA Homology
OSCHINDPR298rice_BlastN
[ Show all 383 ]
DNA
gggatcattacagcggacgcaaaccttgcgggcctaggaatacatgtaca
tttagccgtcgcgagaancccgaaggagtaaaccgcgcaggtaacactgc
tatgaccctcctcctcaatagcaacagtttatccgggcaactccctgcaa
acttgggcctctccaagttgagctacctcgccgtcgccaacaacaagctc
accgggccaatcccaccatcaatcgcgcacatgcaagactccctcctcga
ggtactcctcctcaacaaccagctctccggctgcctccccaacgagctcg
gcatgtcaccaagaccgccgtcatcgacgcggcatgaaccagtnaacggg
ctgattccgtcatcttctcgtggctcagcagcgtcgagcagctcaaccgt
acaagcggntgcggcgagctcgtgccgnattctgnaacccgggggggttn
actagttctagaacgggcgncaacgcggtggagcttccagttttgttncc
tttaatgangggttaattcgnnttgggggaatcaaggncaaagnggttcc
cgngggaaaatgttatccgtcanaattccnanaaaatngggcnggagcta
aagtttaanccggggggncaaagnnngggtaatcaattaatgggtnggta
atgccggtttcatngggnaa
BLAST
BLAST Search