Query (optional)   in Class  

GrainGenes Sequence Report: BCD1779_WHE04C10.s1

[ Submit comment/correction ]

Sequence
BCD1779_WHE04C10.s1
Probe
BCD1779
DNA Homology
D44466416noncereal_BlastN
[ Show all 31 ]
DNA
ggcaatgccaagtgccaaacccctgataatcttttcatgttgtgtatcat
gtgcataagcgagcatctcagtggccttctcgctggctgtcccaaccatg
agcaaacccatgccaataccagctgcttcaccagccacagcactgtctgt
gtaaaggacattctttatgtcttcaaacacttcttcatctgctgtcccca
gagatgcaagcccaagtcccaaacaggnaccatgctggatgacctctgca
ctggtgttgcganggntttcacggaggaattgtttgattccttcaccatg
gttggcatgaatcaaacctaaagcatagangggaccaccttccgagtatg
ggactgccaccaccaactgnaccactttgaggnaggtatgggggccatca
aagcccggacctgctggaaggggggctctnn
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.