Query (optional)   in Class  

GrainGenes Sequence Report: BCD1931_WHE04E08.s1

[Submit comment/correction]

Sequence
BCD1931_WHE04E08.s1
Probe
BCD1931
DNA Homology
NMU25839127noncereal_BlastN
PPU40200126noncereal_BlastN
SEERYGENE120noncereal_BlastN
SEU77459120noncereal_BlastN
DNA
tagatatgcagagtttaatgcagctgatcaacgccctttaagaccagacg
aggcagaactttttgagaagtcggcgcaaaatgcttacgcatcgtttcga
gataaagcagccatgtcacgctcaatgagtattgaccagatggagaattt
tgcacaaggtcgagtttggggtggccaagatgcagcttcaagagggttgg
ttgattcgctaggtggattctcacaagcgccnnattttgttnntaaatna
agnnnnatnnnnaaanaaannnnaagngnnnnnagnannggnggagnnnn
anaaagngngannanaaannaagaaannnnnnnnnnnganangggnagga
nnggntnggggaganananngnnagnnagnagnnagagagngnangnana
aanannngngnangnnnnggngggggnaaaananaananagnnnancgct
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.